\
| Variant ID: vg0529371054 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 29371054 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 254. )
GTATCTCATGAGCCTGTTCGACTACAGAACGGTTGTTAGCCATCTTGTAGTCATGAAACTGCTCCATGATATACAGATCATTGCTAGCATCAGTAGCACC[A/G]
AATTTAGTATTCAGTGCATCCCACAATTCCTTAGCGTCGGTCATATGCATATACACCTCGACAAGACGATCGCCAAGCACGCTAAGAATGCATCCCATAA
TTATGGGATGCATTCTTAGCGTGCTTGGCGATCGTCTTGTCGAGGTGTATATGCATATGACCGACGCTAAGGAATTGTGGGATGCACTGAATACTAAATT[T/C]
GGTGCTACTGATGCTAGCAATGATCTGTATATCATGGAGCAGTTTCATGACTACAAGATGGCTAACAACCGTTCTGTAGTCGAACAGGCTCATGAGATAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.50% | 36.20% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 94.30% | 5.40% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 2.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 83.40% | 16.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 97.70% | 1.90% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 6.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.10% | 86.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 41.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0529371054 | A -> G | LOC_Os05g51200.1 | synonymous_variant ; p.Phe94Phe; LOW | synonymous_codon | Average:18.383; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0529371054 | 2.02E-06 | NA | mr1161 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371054 | NA | 2.36E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371054 | NA | 2.37E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371054 | NA | 9.61E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371054 | NA | 3.50E-07 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371054 | NA | 1.09E-28 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371054 | NA | 2.60E-08 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371054 | NA | 8.70E-17 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371054 | NA | 2.35E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371054 | NA | 1.11E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |