\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529367142:

Variant ID: vg0529367142 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 29367142
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGCAAGCAAGTTTCACTCAGAGTCTTATCTGGTACTAGATCGTCTGTAGACTACCCCTCGGGTGGAGCGTATAAGTCATACTCCTAGTTCTTTAGTAA[A/G]
CTTCCTAGAAGATTCACCCAAAATCTTCATAGACTGCGACCAACAGTCAAGCTTACAAAGGTGAGTTCTTTCAAGAATGCTTTGCAGGACAGCATCTTCG

Reverse complement sequence

CGAAGATGCTGTCCTGCAAAGCATTCTTGAAAGAACTCACCTTTGTAAGCTTGACTGTTGGTCGCAGTCTATGAAGATTTTGGGTGAATCTTCTAGGAAG[T/C]
TTACTAAAGAACTAGGAGTATGACTTATACGCTCCACCCGAGGGGTAGTCTACAGACGATCTAGTACCAGATAAGACTCTGAGTGAAACTTGCTTGCACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 23.40% 2.37% 11.00% NA
All Indica  2759 94.20% 1.60% 1.23% 3.01% NA
All Japonica  1512 4.80% 65.80% 2.05% 27.31% NA
Aus  269 98.10% 0.70% 1.12% 0.00% NA
Indica I  595 98.00% 0.30% 0.50% 1.18% NA
Indica II  465 83.00% 3.40% 1.29% 12.26% NA
Indica III  913 97.60% 0.90% 1.31% 0.22% NA
Indica Intermediate  786 94.00% 2.20% 1.65% 2.16% NA
Temperate Japonica  767 0.30% 97.50% 1.30% 0.91% NA
Tropical Japonica  504 13.30% 10.10% 1.98% 74.60% NA
Japonica Intermediate  241 1.70% 81.30% 4.56% 12.45% NA
VI/Aromatic  96 6.20% 47.90% 36.46% 9.38% NA
Intermediate  90 51.10% 22.20% 10.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0529367142 A -> DEL N N silent_mutation Average:18.268; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0529367142 A -> G LOC_Os05g51190.2 upstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:18.268; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0529367142 A -> G LOC_Os05g51190.5 upstream_gene_variant ; 3021.0bp to feature; MODIFIER silent_mutation Average:18.268; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0529367142 A -> G LOC_Os05g51190.3 upstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:18.268; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0529367142 A -> G LOC_Os05g51190.4 upstream_gene_variant ; 2447.0bp to feature; MODIFIER silent_mutation Average:18.268; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0529367142 A -> G LOC_Os05g51200.1 downstream_gene_variant ; 382.0bp to feature; MODIFIER silent_mutation Average:18.268; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0529367142 A -> G LOC_Os05g51190-LOC_Os05g51200 intergenic_region ; MODIFIER silent_mutation Average:18.268; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0529367142 NA 3.25E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 1.96E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 9.46E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 9.64E-06 7.55E-24 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 3.10E-24 mr1588 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 7.88E-06 8.96E-07 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 9.22E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 1.54E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 2.64E-39 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 2.03E-37 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 2.68E-54 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 6.35E-17 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 8.86E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 1.12E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 2.11E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 8.15E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 1.45E-29 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 3.33E-10 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 3.02E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 5.45E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 1.02E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 1.36E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 9.14E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 5.35E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 1.86E-07 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529367142 NA 7.49E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251