\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529227658:

Variant ID: vg0529227658 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 29227658
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TATCAACTGATGCTCAGTCTGTATAATACTTTCTGAAGTCTGAACCTGAAGAATTGAGTAGCAACTCTGAACCCGGGAGTTGAAACTATTTTAATCCCTT[G/A]
AGAGAATATCCCCTCGTTGATCGCATGTCACTTAAATGATTATGAAAAAAATTGAGAAGATATATTAACACATGATATATCACTTTATAAATATGTAAGT

Reverse complement sequence

ACTTACATATTTATAAAGTGATATATCATGTGTTAATATATCTTCTCAATTTTTTTCATAATCATTTAAGTGACATGCGATCAACGAGGGGATATTCTCT[C/T]
AAGGGATTAAAATAGTTTCAACTCCCGGGTTCAGAGTTGCTACTCAATTCTTCAGGTTCAGACTTCAGAAAGTATTATACAGACTGAGCATCAGTTGATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 42.80% 0.59% 0.02% NA
All Indica  2759 89.90% 9.20% 0.91% 0.00% NA
All Japonica  1512 4.80% 95.00% 0.07% 0.07% NA
Aus  269 23.40% 76.60% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 77.60% 21.70% 0.65% 0.00% NA
Indica III  913 93.20% 5.40% 1.42% 0.00% NA
Indica Intermediate  786 86.60% 12.20% 1.15% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 12.90% 86.90% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.00% 0.41% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0529227658 G -> DEL N N silent_mutation Average:82.422; most accessible tissue: Minghui63 flag leaf, score: 96.836 N N N N
vg0529227658 G -> A LOC_Os05g50940.1 upstream_gene_variant ; 596.0bp to feature; MODIFIER silent_mutation Average:82.422; most accessible tissue: Minghui63 flag leaf, score: 96.836 N N N N
vg0529227658 G -> A LOC_Os05g50920.1 downstream_gene_variant ; 3179.0bp to feature; MODIFIER silent_mutation Average:82.422; most accessible tissue: Minghui63 flag leaf, score: 96.836 N N N N
vg0529227658 G -> A LOC_Os05g50930.1 downstream_gene_variant ; 35.0bp to feature; MODIFIER silent_mutation Average:82.422; most accessible tissue: Minghui63 flag leaf, score: 96.836 N N N N
vg0529227658 G -> A LOC_Os05g50930.2 downstream_gene_variant ; 35.0bp to feature; MODIFIER silent_mutation Average:82.422; most accessible tissue: Minghui63 flag leaf, score: 96.836 N N N N
vg0529227658 G -> A LOC_Os05g50930-LOC_Os05g50940 intergenic_region ; MODIFIER silent_mutation Average:82.422; most accessible tissue: Minghui63 flag leaf, score: 96.836 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0529227658 G A 0.0 0.0 -0.02 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0529227658 NA 3.24E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 1.36E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 9.07E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 1.48E-17 mr1592 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 6.49E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 5.52E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 1.70E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 7.10E-10 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 5.37E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 7.59E-33 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 3.74E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529227658 NA 1.67E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251