Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528832429:

Variant ID: vg0528832429 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 28832429
Reference Allele: GT	Alternative Allele: AT,G
Primary Allele: GT	Secondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCATCCTAAAATAATAAGGGCTTGTTCACTTTGATACCATTTTCAACCTTACCAAATTTTAATAAAGTTGCTAAAAAAATTGCTACATTTAGTTTGCT[GT/AT,G]
CAAATTTTGGTAACTATATAAGAAATCCTACCAAAATTTTGGCAAGTTGCCAAAATTTGGTAAGTTTTTTTTTCATCAAAGTGAACAGGCCCCAAGTTCA

Reverse complement sequence

TGAACTTGGGGCCTGTTCACTTTGATGAAAAAAAAACTTACCAAATTTTGGCAACTTGCCAAAATTTTGGTAGGATTTCTTATATAGTTACCAAAATTTG[AC/AT,C]
AGCAAACTAAATGTAGCAATTTTTTTAGCAACTTTATTAAAATTTGGTAAGGTTGAAAATGGTATCAAAGTGAACAAGCCCTTATTATTTTAGGATGGAG

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	44.90%	0.08%	0.00%	G: 0.04%
All Indica	2759	33.60%	66.30%	0.11%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	6.30%	93.70%	0.00%	0.00%	NA
Indica I	595	75.00%	24.90%	0.17%	0.00%	NA
Indica II	465	45.20%	54.80%	0.00%	0.00%	NA
Indica III	913	2.00%	98.00%	0.00%	0.00%	NA
Indica Intermediate	786	32.10%	67.70%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	71.10%	25.60%	1.11%	0.00%	G: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0528832429	GT -> G	LOC_Os05g50310.1	upstream_gene_variant ; 3344.0bp to feature; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0528832429	GT -> G	LOC_Os05g50290.1	downstream_gene_variant ; 4367.0bp to feature; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0528832429	GT -> G	LOC_Os05g50300.1	downstream_gene_variant ; 299.0bp to feature; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0528832429	GT -> G	LOC_Os05g50320.1	downstream_gene_variant ; 4974.0bp to feature; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0528832429	GT -> G	LOC_Os05g50300-LOC_Os05g50310	intergenic_region ; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0528832429	GT -> AT	LOC_Os05g50310.1	upstream_gene_variant ; 3345.0bp to feature; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0528832429	GT -> AT	LOC_Os05g50290.1	downstream_gene_variant ; 4366.0bp to feature; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0528832429	GT -> AT	LOC_Os05g50300.1	downstream_gene_variant ; 298.0bp to feature; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0528832429	GT -> AT	LOC_Os05g50320.1	downstream_gene_variant ; 4975.0bp to feature; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0528832429	GT -> AT	LOC_Os05g50300-LOC_Os05g50310	intergenic_region ; MODIFIER	silent_mutation	Average:43.819; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0528832429	NA	4.23E-08	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528832429	NA	1.80E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528832429	NA	7.23E-08	mr1252	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528832429	NA	4.96E-09	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528832429	NA	9.78E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528832429	NA	6.98E-06	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528832429	NA	1.89E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528832429	NA	8.53E-10	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528832429	NA	8.85E-09	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528832429	NA	2.49E-11	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251