\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528796740:

Variant ID: vg0528796740 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 28796740
Reference Allele: TAlternative Allele: C,TGAGATTATG
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGTCCAATTTTTGTTCCAATTCCTGGAAATTTTTTTGAGTGACTGAACCATTTTGCTATTTTGGCAAAAAGTCCAAGGGAGTGAATGAAATTGCTT[T/C,TGAGATTATG]
GGTCTCCAATTTTTGTTGTTGTTATTTTTATTTGAGTGACTGAACCGTTTTGCTACTTAATTTGGAATGGGAACTTTTGCCCATTAAGATAATCAACTTC

Reverse complement sequence

GAAGTTGATTATCTTAATGGGCAAAAGTTCCCATTCCAAATTAAGTAGCAAAACGGTTCAGTCACTCAAATAAAAATAACAACAACAAAAATTGGAGACC[A/G,CATAATCTCA]
AAGCAATTTCATTCACTCCCTTGGACTTTTTGCCAAAATAGCAAAATGGTTCAGTCACTCAAAAAAATTTCCAGGAATTGGAACAAAAATTGGACTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 31.20% 4.78% 0.00% TGAGATTATG: 0.11%
All Indica  2759 94.60% 1.50% 3.88% 0.00% TGAGATTATG: 0.04%
All Japonica  1512 2.90% 89.40% 7.41% 0.00% TGAGATTATG: 0.26%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.20% 0.84% 0.00% NA
Indica II  465 81.10% 3.40% 15.48% 0.00% NA
Indica III  913 99.10% 0.80% 0.11% 0.00% NA
Indica Intermediate  786 93.90% 2.30% 3.69% 0.00% TGAGATTATG: 0.13%
Temperate Japonica  767 0.50% 99.20% 0.26% 0.00% NA
Tropical Japonica  504 7.30% 71.40% 20.63% 0.00% TGAGATTATG: 0.60%
Japonica Intermediate  241 1.20% 95.90% 2.49% 0.00% TGAGATTATG: 0.41%
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 54.40% 37.80% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528796740 T -> TGAGATTATG LOC_Os05g50250.1 intron_variant ; MODIFIER silent_mutation Average:44.521; most accessible tissue: Zhenshan97 flower, score: 90.156 N N N N
vg0528796740 T -> C LOC_Os05g50250.1 intron_variant ; MODIFIER silent_mutation Average:44.521; most accessible tissue: Zhenshan97 flower, score: 90.156 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0528796740 T C -0.04 -0.02 -0.02 -0.01 -0.07 -0.14
vg0528796740 T TGAGA* 0.06 0.04 0.12 0.03 0.18 0.31

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528796740 NA 1.62E-08 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 4.41E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 7.27E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 1.10E-14 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 9.91E-20 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 2.33E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 3.30E-29 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 5.50E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 8.29E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 3.25E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 1.04E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 3.42E-37 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 2.87E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 8.30E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 5.93E-41 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 7.69E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 7.34E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 9.54E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 7.37E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 4.31E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 7.52E-23 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 1.66E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 NA 6.40E-07 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528796740 4.44E-08 1.76E-12 mr1850_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251