| Variant ID: vg0528707749 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 28707749 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 90. )
GTTGGCCATGGCACATAGTCGTCGCCGGTGAGCTCCTCCGGCTCATGGAGGAGGAAGAAGTGGAGCCAAGGGTAATATCATCCAGGATGGCATTTCGGCG[A/G]
AGCCGTCTTCGTTGAACGTGGTATTTTACTGAAACTGTTTTAAGGATAGCATTCTAGTGAAGTCATTCTTTTGCAATGGTACATATGCAATTCCCCCCCT
AGGGGGGGAATTGCATATGTACCATTGCAAAAGAATGACTTCACTAGAATGCTATCCTTAAAACAGTTTCAGTAAAATACCACGTTCAACGAAGACGGCT[T/C]
CGCCGAAATGCCATCCTGGATGATATTACCCTTGGCTCCACTTCTTCCTCCTCCATGAGCCGGAGGAGCTCACCGGCGACGACTATGTGCCATGGCCAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 13.00% | 2.88% | 0.87% | NA |
| All Indica | 2759 | 74.40% | 21.40% | 4.10% | 0.04% | NA |
| All Japonica | 1512 | 94.70% | 1.40% | 1.32% | 2.58% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 0.70% | 3.53% | 0.00% | NA |
| Indica II | 465 | 76.60% | 17.40% | 6.02% | 0.00% | NA |
| Indica III | 913 | 56.10% | 42.80% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 78.40% | 14.60% | 6.87% | 0.13% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 1.17% | 2.22% | NA |
| Tropical Japonica | 504 | 93.80% | 4.00% | 1.79% | 0.40% | NA |
| Japonica Intermediate | 241 | 90.50% | 0.40% | 0.83% | 8.30% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 1.10% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0528707749 | A -> DEL | N | N | silent_mutation | Average:65.283; most accessible tissue: Callus, score: 93.07 | N | N | N | N |
| vg0528707749 | A -> G | LOC_Os05g50080.1 | downstream_gene_variant ; 3242.0bp to feature; MODIFIER | silent_mutation | Average:65.283; most accessible tissue: Callus, score: 93.07 | N | N | N | N |
| vg0528707749 | A -> G | LOC_Os05g50100.1 | downstream_gene_variant ; 2571.0bp to feature; MODIFIER | silent_mutation | Average:65.283; most accessible tissue: Callus, score: 93.07 | N | N | N | N |
| vg0528707749 | A -> G | LOC_Os05g50090.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.283; most accessible tissue: Callus, score: 93.07 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0528707749 | NA | 2.50E-08 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0528707749 | NA | 5.02E-09 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707749 | 7.21E-06 | 4.79E-09 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707749 | 3.28E-06 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707749 | 1.42E-07 | 1.64E-10 | mr1116 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707749 | 8.89E-08 | 3.81E-17 | mr1118 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707749 | 2.91E-06 | 3.50E-09 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707749 | NA | 2.73E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707749 | 3.18E-07 | 7.33E-15 | mr1183 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707749 | 3.36E-06 | 2.60E-09 | mr1183 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/