\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528707749:

Variant ID: vg0528707749 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28707749
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGGCCATGGCACATAGTCGTCGCCGGTGAGCTCCTCCGGCTCATGGAGGAGGAAGAAGTGGAGCCAAGGGTAATATCATCCAGGATGGCATTTCGGCG[A/G]
AGCCGTCTTCGTTGAACGTGGTATTTTACTGAAACTGTTTTAAGGATAGCATTCTAGTGAAGTCATTCTTTTGCAATGGTACATATGCAATTCCCCCCCT

Reverse complement sequence

AGGGGGGGAATTGCATATGTACCATTGCAAAAGAATGACTTCACTAGAATGCTATCCTTAAAACAGTTTCAGTAAAATACCACGTTCAACGAAGACGGCT[T/C]
CGCCGAAATGCCATCCTGGATGATATTACCCTTGGCTCCACTTCTTCCTCCTCCATGAGCCGGAGGAGCTCACCGGCGACGACTATGTGCCATGGCCAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 13.00% 2.88% 0.87% NA
All Indica  2759 74.40% 21.40% 4.10% 0.04% NA
All Japonica  1512 94.70% 1.40% 1.32% 2.58% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.80% 0.70% 3.53% 0.00% NA
Indica II  465 76.60% 17.40% 6.02% 0.00% NA
Indica III  913 56.10% 42.80% 1.10% 0.00% NA
Indica Intermediate  786 78.40% 14.60% 6.87% 0.13% NA
Temperate Japonica  767 96.60% 0.00% 1.17% 2.22% NA
Tropical Japonica  504 93.80% 4.00% 1.79% 0.40% NA
Japonica Intermediate  241 90.50% 0.40% 0.83% 8.30% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 1.10% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528707749 A -> DEL N N silent_mutation Average:65.283; most accessible tissue: Callus, score: 93.07 N N N N
vg0528707749 A -> G LOC_Os05g50080.1 downstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:65.283; most accessible tissue: Callus, score: 93.07 N N N N
vg0528707749 A -> G LOC_Os05g50100.1 downstream_gene_variant ; 2571.0bp to feature; MODIFIER silent_mutation Average:65.283; most accessible tissue: Callus, score: 93.07 N N N N
vg0528707749 A -> G LOC_Os05g50090.1 intron_variant ; MODIFIER silent_mutation Average:65.283; most accessible tissue: Callus, score: 93.07 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528707749 NA 2.50E-08 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528707749 NA 5.02E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 7.21E-06 4.79E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 3.28E-06 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 1.42E-07 1.64E-10 mr1116 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 8.89E-08 3.81E-17 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 2.91E-06 3.50E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 2.73E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 3.18E-07 7.33E-15 mr1183 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 3.36E-06 2.60E-09 mr1183 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 7.35E-07 5.52E-10 mr1247 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 8.43E-08 1.32E-20 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 1.73E-07 4.87E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 1.81E-06 1.16E-08 mr1503 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 2.61E-06 1.48E-14 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 2.01E-06 3.78E-11 mr1794 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 7.60E-06 2.78E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 1.45E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 5.99E-10 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 8.20E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 7.54E-16 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 1.24E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 2.65E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 5.57E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 2.13E-06 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 3.49E-18 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707749 NA 6.14E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251