\
| Variant ID: vg0528707739 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 28707739 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 93. )
TACAGCTAGTGTTGGCCATGGCACATAGTCGTCGCCGGTGAGCTCCTCCGGCTCATGGAGGAGGAAGAAGTGGAGCCAAGGGTAATATCATCCAGGATGG[C/T]
ATTTCGGCGAAGCCGTCTTCGTTGAACGTGGTATTTTACTGAAACTGTTTTAAGGATAGCATTCTAGTGAAGTCATTCTTTTGCAATGGTACATATGCAA
TTGCATATGTACCATTGCAAAAGAATGACTTCACTAGAATGCTATCCTTAAAACAGTTTCAGTAAAATACCACGTTCAACGAAGACGGCTTCGCCGAAAT[G/A]
CCATCCTGGATGATATTACCCTTGGCTCCACTTCTTCCTCCTCCATGAGCCGGAGGAGCTCACCGGCGACGACTATGTGCCATGGCCAACACTAGCTGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.20% | 13.10% | 4.44% | 0.23% | NA |
| All Indica | 2759 | 71.30% | 22.20% | 6.56% | 0.00% | NA |
| All Japonica | 1512 | 97.40% | 0.10% | 1.85% | 0.73% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 31.60% | 45.00% | 23.36% | 0.00% | NA |
| Indica II | 465 | 86.20% | 11.40% | 2.37% | 0.00% | NA |
| Indica III | 913 | 85.40% | 14.00% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 76.00% | 20.70% | 3.31% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 93.30% | 0.00% | 5.36% | 1.39% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0528707739 | C -> T | LOC_Os05g50080.1 | downstream_gene_variant ; 3232.0bp to feature; MODIFIER | silent_mutation | Average:63.444; most accessible tissue: Callus, score: 93.07 | N | N | N | N |
| vg0528707739 | C -> T | LOC_Os05g50100.1 | downstream_gene_variant ; 2581.0bp to feature; MODIFIER | silent_mutation | Average:63.444; most accessible tissue: Callus, score: 93.07 | N | N | N | N |
| vg0528707739 | C -> T | LOC_Os05g50090.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.444; most accessible tissue: Callus, score: 93.07 | N | N | N | N |
| vg0528707739 | C -> DEL | N | N | silent_mutation | Average:63.444; most accessible tissue: Callus, score: 93.07 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0528707739 | 2.26E-09 | 1.08E-38 | mr1026 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | 1.07E-08 | 5.32E-23 | mr1026 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 7.65E-12 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 9.21E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | 9.13E-08 | 3.18E-34 | mr1161 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | 2.04E-07 | 5.62E-20 | mr1161 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 5.31E-06 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 2.63E-14 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 5.61E-06 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 3.05E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 8.69E-17 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 8.30E-17 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 1.41E-17 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 2.44E-24 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 1.15E-18 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 1.10E-06 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 3.34E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707739 | NA | 3.08E-08 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |