\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528707471:

Variant ID: vg0528707471 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28707471
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GGACAATGAGACGGCGGCGAGCGGTAGTAGCTGGTGATGCGGGGACCCAGACTTGGAGCCACTGTGGAAGACAGCGAAAAATTGCCGTGATGGACGACGA[G/A]
GCGGCGGAGCCGTCGATGGCGTCGTGGTTGACCTGTGGCTGTTTGAGGCTGCTTGTTCTGCTTGTTTGCTTGCTGGTTGAGAAGGACGAATTGGCTCTGC

Reverse complement sequence

GCAGAGCCAATTCGTCCTTCTCAACCAGCAAGCAAACAAGCAGAACAAGCAGCCTCAAACAGCCACAGGTCAACCACGACGCCATCGACGGCTCCGCCGC[C/T]
TCGTCGTCCATCACGGCAATTTTTCGCTGTCTTCCACAGTGGCTCCAAGTCTGGGTCCCCGCATCACCAGCTACTACCGCTCGCCGCCGTCTCATTGTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 13.10% 2.77% 0.87% NA
All Indica  2759 74.50% 21.50% 3.91% 0.04% NA
All Japonica  1512 94.70% 1.40% 1.32% 2.58% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.00% 0.70% 3.36% 0.00% NA
Indica II  465 77.00% 16.60% 6.45% 0.00% NA
Indica III  913 56.10% 43.30% 0.66% 0.00% NA
Indica Intermediate  786 78.20% 15.00% 6.62% 0.13% NA
Temperate Japonica  767 96.60% 0.00% 1.17% 2.22% NA
Tropical Japonica  504 93.80% 4.00% 1.79% 0.40% NA
Japonica Intermediate  241 90.50% 0.40% 0.83% 8.30% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 2.20% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528707471 G -> DEL N N silent_mutation Average:69.168; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0528707471 G -> A LOC_Os05g50080.1 downstream_gene_variant ; 2964.0bp to feature; MODIFIER silent_mutation Average:69.168; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0528707471 G -> A LOC_Os05g50100.1 downstream_gene_variant ; 2849.0bp to feature; MODIFIER silent_mutation Average:69.168; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0528707471 G -> A LOC_Os05g50090.1 intron_variant ; MODIFIER silent_mutation Average:69.168; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528707471 NA 4.23E-08 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528707471 9.15E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 5.28E-06 NA mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 5.96E-06 1.54E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 3.03E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 9.13E-07 4.84E-10 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 4.55E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 3.67E-07 8.61E-16 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 2.88E-06 8.50E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 5.65E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 7.30E-07 5.32E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 8.50E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 8.50E-07 1.04E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 2.92E-07 2.31E-19 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 1.29E-07 7.61E-15 mr1503 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 4.87E-06 1.89E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 2.29E-07 9.15E-16 mr1794 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 6.05E-06 1.10E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 5.19E-06 2.54E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 2.45E-09 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 2.10E-10 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 4.09E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 3.19E-14 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 1.43E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 7.47E-10 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 2.75E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 1.19E-06 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 2.66E-06 5.55E-17 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528707471 NA 8.08E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251