| Variant ID: vg0528707182 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 28707182 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 99. )
CGTCCGCCCTCGGTCCAAAACCTGCTTGGCACCGGCCGTGCGCTGCGCGCGAGGAGGAGGCGACTCCGGCTCGGGGCAAGGTCGGACTCGGGAAGCGGAG[G/A]
AGACGAGGCCGTGCGCAGTCGCGTTGTGCATGCACGCCCACCACGTGCTCTCGCCAGCCGCGGGCGCGATGACAACGACCACCGCTGCCATCACCGTCGA
TCGACGGTGATGGCAGCGGTGGTCGTTGTCATCGCGCCCGCGGCTGGCGAGAGCACGTGGTGGGCGTGCATGCACAACGCGACTGCGCACGGCCTCGTCT[C/T]
CTCCGCTTCCCGAGTCCGACCTTGCCCCGAGCCGGAGTCGCCTCCTCCTCGCGCGCAGCGCACGGCCGGTGCCAAGCAGGTTTTGGACCGAGGGCGGACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.20% | 12.90% | 3.91% | 0.00% | NA |
| All Indica | 2759 | 71.40% | 21.90% | 6.67% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 31.60% | 44.90% | 23.53% | 0.00% | NA |
| Indica II | 465 | 86.20% | 11.80% | 1.94% | 0.00% | NA |
| Indica III | 913 | 85.70% | 13.40% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 76.30% | 20.40% | 3.31% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0528707182 | G -> A | LOC_Os05g50080.1 | downstream_gene_variant ; 2675.0bp to feature; MODIFIER | silent_mutation | Average:64.515; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | N | N | N | N |
| vg0528707182 | G -> A | LOC_Os05g50100.1 | downstream_gene_variant ; 3138.0bp to feature; MODIFIER | silent_mutation | Average:64.515; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | N | N | N | N |
| vg0528707182 | G -> A | LOC_Os05g50090.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.515; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0528707182 | 3.72E-07 | 2.18E-36 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707182 | 1.48E-06 | 5.29E-20 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707182 | NA | 2.54E-13 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707182 | 3.33E-06 | 1.47E-32 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707182 | 8.37E-06 | 1.43E-17 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707182 | NA | 3.67E-15 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707182 | NA | 8.33E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707182 | NA | 1.03E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707182 | NA | 4.69E-06 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528707182 | NA | 1.38E-16 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/