| Variant ID: vg0528706863 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 28706863 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 82. )
CATCTCGTTCCCATTCACCTCGTTCTGGCACACGATGCTGAGCCAGTTGGTGTCCTGATGGGGAGAAAATTGCATATGTACCATTGCAAAAGAATGGATT[C/T]
GCTAGAATACCATCCTTAAAACAGGCTTCGGTAAAATACCACGTTCAACGAAGATGGCTTCGCCCGAATGCCCTACTGGACTAATTTGCCCTTGGGCATC
GATGCCCAAGGGCAAATTAGTCCAGTAGGGCATTCGGGCGAAGCCATCTTCGTTGAACGTGGTATTTTACCGAAGCCTGTTTTAAGGATGGTATTCTAGC[G/A]
AATCCATTCTTTTGCAATGGTACATATGCAATTTTCTCCCCATCAGGACACCAACTGGCTCAGCATCGTGTGCCAGAACGAGGTGAATGGGAACGAGATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.20% | 12.80% | 2.96% | 1.02% | NA |
| All Indica | 2759 | 74.70% | 21.20% | 4.02% | 0.04% | NA |
| All Japonica | 1512 | 94.00% | 1.30% | 1.72% | 2.98% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 0.70% | 3.36% | 0.00% | NA |
| Indica II | 465 | 77.40% | 16.60% | 6.02% | 0.00% | NA |
| Indica III | 913 | 56.20% | 42.80% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 78.60% | 14.40% | 6.87% | 0.13% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 1.30% | 2.09% | NA |
| Tropical Japonica | 504 | 91.50% | 3.80% | 2.78% | 1.98% | NA |
| Japonica Intermediate | 241 | 90.90% | 0.40% | 0.83% | 7.88% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 2.20% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0528706863 | C -> T | LOC_Os05g50080.1 | downstream_gene_variant ; 2356.0bp to feature; MODIFIER | silent_mutation | Average:59.761; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg0528706863 | C -> T | LOC_Os05g50100.1 | downstream_gene_variant ; 3457.0bp to feature; MODIFIER | silent_mutation | Average:59.761; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg0528706863 | C -> T | LOC_Os05g50090.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.761; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg0528706863 | C -> DEL | N | N | silent_mutation | Average:59.761; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0528706863 | NA | 5.60E-08 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0528706863 | 5.14E-06 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528706863 | 3.08E-06 | NA | mr1110 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528706863 | 7.40E-06 | 1.85E-09 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528706863 | NA | 3.79E-09 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528706863 | 5.38E-06 | 3.48E-09 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528706863 | 1.81E-07 | 2.99E-16 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528706863 | NA | 3.76E-08 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528706863 | NA | 1.29E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528706863 | 2.69E-06 | 5.01E-15 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/