\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528706863:

Variant ID: vg0528706863 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28706863
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTCGTTCCCATTCACCTCGTTCTGGCACACGATGCTGAGCCAGTTGGTGTCCTGATGGGGAGAAAATTGCATATGTACCATTGCAAAAGAATGGATT[C/T]
GCTAGAATACCATCCTTAAAACAGGCTTCGGTAAAATACCACGTTCAACGAAGATGGCTTCGCCCGAATGCCCTACTGGACTAATTTGCCCTTGGGCATC

Reverse complement sequence

GATGCCCAAGGGCAAATTAGTCCAGTAGGGCATTCGGGCGAAGCCATCTTCGTTGAACGTGGTATTTTACCGAAGCCTGTTTTAAGGATGGTATTCTAGC[G/A]
AATCCATTCTTTTGCAATGGTACATATGCAATTTTCTCCCCATCAGGACACCAACTGGCTCAGCATCGTGTGCCAGAACGAGGTGAATGGGAACGAGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 12.80% 2.96% 1.02% NA
All Indica  2759 74.70% 21.20% 4.02% 0.04% NA
All Japonica  1512 94.00% 1.30% 1.72% 2.98% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.00% 0.70% 3.36% 0.00% NA
Indica II  465 77.40% 16.60% 6.02% 0.00% NA
Indica III  913 56.20% 42.80% 0.99% 0.00% NA
Indica Intermediate  786 78.60% 14.40% 6.87% 0.13% NA
Temperate Japonica  767 96.60% 0.00% 1.30% 2.09% NA
Tropical Japonica  504 91.50% 3.80% 2.78% 1.98% NA
Japonica Intermediate  241 90.90% 0.40% 0.83% 7.88% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 2.20% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528706863 C -> T LOC_Os05g50080.1 downstream_gene_variant ; 2356.0bp to feature; MODIFIER silent_mutation Average:59.761; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0528706863 C -> T LOC_Os05g50100.1 downstream_gene_variant ; 3457.0bp to feature; MODIFIER silent_mutation Average:59.761; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0528706863 C -> T LOC_Os05g50090.1 intron_variant ; MODIFIER silent_mutation Average:59.761; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0528706863 C -> DEL N N silent_mutation Average:59.761; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528706863 NA 5.60E-08 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528706863 5.14E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 3.08E-06 NA mr1110 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 7.40E-06 1.85E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 3.79E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 5.38E-06 3.48E-09 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 1.81E-07 2.99E-16 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 3.76E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 1.29E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 2.69E-06 5.01E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 8.29E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 5.23E-06 7.70E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 8.41E-08 2.96E-20 mr1495 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 8.63E-07 1.05E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 1.90E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 1.37E-13 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 1.11E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 1.19E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 5.50E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 4.42E-09 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 3.92E-10 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 6.97E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 7.74E-15 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 3.75E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 1.40E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 7.07E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 2.92E-06 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 8.48E-07 9.57E-18 mr1495_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 3.73E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528706863 NA 1.44E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251