\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528653684:

Variant ID: vg0528653684 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28653684
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:


TCAACTTCTATAAAATTGTAACAAACATAACAAACAAAACTCAAATTACTGTACGTATATTTACAGTTAAATTTGATATTTTTGTAACAATTTATAGAAG[C/T]
TGAATTTGAAATTACATGTGTTGTGGAGTGATATATTTCATATTAATCTATCTTGTCAATTTTTTTGATTTTTTATTGTAATCATTTAGTTGACATGCAA

Reverse complement sequence

TTGCATGTCAACTAAATGATTACAATAAAAAATCAAAAAAATTGACAAGATAGATTAATATGAAATATATCACTCCACAACACATGTAATTTCAAATTCA[G/A]
CTTCTATAAATTGTTACAAAAATATCAAATTTAACTGTAAATATACGTACAGTAATTTGAGTTTTGTTTGTTATGTTTGTTACAATTTTATAGAAGTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 7.60% 1.52% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 72.80% 22.60% 4.70% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 55.30% 36.50% 8.21% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 73.40% 23.20% 3.32% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528653684 C -> T LOC_Os05g49970.1 upstream_gene_variant ; 1046.0bp to feature; MODIFIER silent_mutation Average:39.568; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0528653684 C -> T LOC_Os05g49970.3 upstream_gene_variant ; 1046.0bp to feature; MODIFIER silent_mutation Average:39.568; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0528653684 C -> T LOC_Os05g49970.2 upstream_gene_variant ; 2439.0bp to feature; MODIFIER silent_mutation Average:39.568; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0528653684 C -> T LOC_Os05g49950.1 downstream_gene_variant ; 3309.0bp to feature; MODIFIER silent_mutation Average:39.568; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0528653684 C -> T LOC_Os05g49960.1 downstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:39.568; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0528653684 C -> T LOC_Os05g49960-LOC_Os05g49970 intergenic_region ; MODIFIER silent_mutation Average:39.568; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528653684 NA 7.96E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528653684 NA 7.45E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528653684 4.68E-06 4.69E-06 mr1958_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528653684 6.31E-06 6.31E-06 mr1958_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251