\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528650875:

Variant ID: vg0528650875 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28650875
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAATACTGCCGAGAGACCTTTTTGCACGATTTGCACGATTTGGTAAATTGGGGGATGCGTTGTATGTGGTTTTGTGGTGTAGGGATGAATTTCGAACTC[G/A]
GCTACAAGTTAAGGGACCTCGAGTGAACTTATTCCTTTTTGTGCGAGTAAGCGCCTGCCGTTTAACGTTGGTTGAAAATCGTGCGGTCCAAGGTCTCCAT

Reverse complement sequence

ATGGAGACCTTGGACCGCACGATTTTCAACCAACGTTAAACGGCAGGCGCTTACTCGCACAAAAAGGAATAAGTTCACTCGAGGTCCCTTAACTTGTAGC[C/T]
GAGTTCGAAATTCATCCCTACACCACAAAACCACATACAACGCATCCCCCAATTTACCAAATCGTGCAAATCGTGCAAAAAGGTCTCTCGGCAGTATTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 9.30% 0.42% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 72.50% 26.30% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 96.60% 2.20% 1.17% 0.00% NA
Tropical Japonica  504 47.40% 51.80% 0.79% 0.00% NA
Japonica Intermediate  241 48.10% 49.40% 2.49% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528650875 G -> A LOC_Os05g49960.1 upstream_gene_variant ; 1349.0bp to feature; MODIFIER silent_mutation Average:85.14; most accessible tissue: Callus, score: 93.824 N N N N
vg0528650875 G -> A LOC_Os05g49970.1 upstream_gene_variant ; 3855.0bp to feature; MODIFIER silent_mutation Average:85.14; most accessible tissue: Callus, score: 93.824 N N N N
vg0528650875 G -> A LOC_Os05g49970.3 upstream_gene_variant ; 3855.0bp to feature; MODIFIER silent_mutation Average:85.14; most accessible tissue: Callus, score: 93.824 N N N N
vg0528650875 G -> A LOC_Os05g49940.1 downstream_gene_variant ; 2631.0bp to feature; MODIFIER silent_mutation Average:85.14; most accessible tissue: Callus, score: 93.824 N N N N
vg0528650875 G -> A LOC_Os05g49950.1 downstream_gene_variant ; 500.0bp to feature; MODIFIER silent_mutation Average:85.14; most accessible tissue: Callus, score: 93.824 N N N N
vg0528650875 G -> A LOC_Os05g49950-LOC_Os05g49960 intergenic_region ; MODIFIER silent_mutation Average:85.14; most accessible tissue: Callus, score: 93.824 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0528650875 G A 0.0 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528650875 NA 1.67E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 2.07E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 5.38E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 1.63E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 3.01E-10 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 8.72E-11 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 8.54E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 4.49E-07 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 3.54E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 7.55E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 2.62E-06 5.51E-08 mr1621_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 1.80E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 8.49E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 5.90E-13 mr1794_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 3.94E-12 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 4.05E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 3.54E-09 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 2.15E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528650875 NA 3.15E-07 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251