\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528575652:

Variant ID: vg0528575652 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28575652
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCTAATTACGTCATGATTTGACAATGTGGTGCTACAGTAAACATTTACTAATAATAGATTAATTAGGCTTAATAAATTCGTCTCACAGTTAACATACG[G/A]
AATATGTAATTTGTTTTGTTATTAGTCTACGTTTAATATTTTAAATGTGTGTCCGTATACTTAAAAAAAATTTGGCTAAAGAACTAACCACAGCCAATGT

Reverse complement sequence

ACATTGGCTGTGGTTAGTTCTTTAGCCAAATTTTTTTTAAGTATACGGACACACATTTAAAATATTAAACGTAGACTAATAACAAAACAAATTACATATT[C/T]
CGTATGTTAACTGTGAGACGAATTTATTAAGCCTAATTAATCTATTATTAGTAAATGTTTACTGTAGCACCACATTGTCAAATCATGACGTAATTAGGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 9.80% 0.36% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 72.10% 26.90% 1.06% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 96.50% 2.60% 0.91% 0.00% NA
Tropical Japonica  504 47.60% 52.20% 0.20% 0.00% NA
Japonica Intermediate  241 45.60% 51.00% 3.32% 0.00% NA
VI/Aromatic  96 57.30% 41.70% 1.04% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528575652 G -> A LOC_Os05g49780.1 downstream_gene_variant ; 419.0bp to feature; MODIFIER silent_mutation Average:58.39; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N
vg0528575652 G -> A LOC_Os05g49790.1 downstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:58.39; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N
vg0528575652 G -> A LOC_Os05g49800.1 downstream_gene_variant ; 3542.0bp to feature; MODIFIER silent_mutation Average:58.39; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N
vg0528575652 G -> A LOC_Os05g49780-LOC_Os05g49790 intergenic_region ; MODIFIER silent_mutation Average:58.39; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528575652 NA 4.55E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652 NA 2.04E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652 NA 1.04E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652 NA 7.24E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652 NA 1.65E-11 mr1180_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652 NA 1.34E-11 mr1183_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652 NA 1.39E-12 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251