Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0528575652:

Variant ID: vg0528575652 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 28575652
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AGCCTAATTACGTCATGATTTGACAATGTGGTGCTACAGTAAACATTTACTAATAATAGATTAATTAGGCTTAATAAATTCGTCTCACAGTTAACATACG[G/A]
AATATGTAATTTGTTTTGTTATTAGTCTACGTTTAATATTTTAAATGTGTGTCCGTATACTTAAAAAAAATTTGGCTAAAGAACTAACCACAGCCAATGT

Reverse complement sequence

ACATTGGCTGTGGTTAGTTCTTTAGCCAAATTTTTTTTAAGTATACGGACACACATTTAAAATATTAAACGTAGACTAATAACAAAACAAATTACATATT[C/T]
CGTATGTTAACTGTGAGACGAATTTATTAAGCCTAATTAATCTATTATTAGTAAATGTTTACTGTAGCACCACATTGTCAAATCATGACGTAATTAGGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	9.80%	0.36%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	72.10%	26.90%	1.06%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	96.50%	2.60%	0.91%	0.00%	NA
Tropical Japonica	504	47.60%	52.20%	0.20%	0.00%	NA
Japonica Intermediate	241	45.60%	51.00%	3.32%	0.00%	NA
VI/Aromatic	96	57.30%	41.70%	1.04%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0528575652	G -> A	LOC_Os05g49780.1	downstream_gene_variant ; 419.0bp to feature; MODIFIER	silent_mutation	Average:58.39; most accessible tissue: Zhenshan97 root, score: 85.044	N	N	N	N
vg0528575652	G -> A	LOC_Os05g49790.1	downstream_gene_variant ; 2395.0bp to feature; MODIFIER	silent_mutation	Average:58.39; most accessible tissue: Zhenshan97 root, score: 85.044	N	N	N	N
vg0528575652	G -> A	LOC_Os05g49800.1	downstream_gene_variant ; 3542.0bp to feature; MODIFIER	silent_mutation	Average:58.39; most accessible tissue: Zhenshan97 root, score: 85.044	N	N	N	N
vg0528575652	G -> A	LOC_Os05g49780-LOC_Os05g49790	intergenic_region ; MODIFIER	silent_mutation	Average:58.39; most accessible tissue: Zhenshan97 root, score: 85.044	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0528575652	NA	4.55E-07	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652	NA	2.04E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652	NA	1.04E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652	NA	7.24E-07	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652	NA	1.65E-11	mr1180_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652	NA	1.34E-11	mr1183_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528575652	NA	1.39E-12	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251