\
| Variant ID: vg0528501350 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 28501350 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 111. )
GCTGTCCTCGTCTACAAGGAACGGCTGCAGGGGCCGACCGCACGTGTCGGGGTGCTCCTCCCCTAACGGAATGCCCAGCTATATCTAGTAGGAATCACCT[G/A]
ATACCTGGTAGGTATCATTCGATACCTCGCAAGTATCACATGATACATGGTAGAAATCGTCTGATACCTGACAAGTATCACATGATACGATACGTGGTAG
CTACCACGTATCGTATCATGTGATACTTGTCAGGTATCAGACGATTTCTACCATGTATCATGTGATACTTGCGAGGTATCGAATGATACCTACCAGGTAT[C/T]
AGGTGATTCCTACTAGATATAGCTGGGCATTCCGTTAGGGGAGGAGCACCCCGACACGTGCGGTCGGCCCCTGCAGCCGTTCCTTGTAGACGAGGACAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.50% | 30.50% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 60.90% | 39.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 15.20% | 84.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 51.20% | 48.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 40.00% | 59.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 64.20% | 35.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0528501350 | G -> A | LOC_Os05g49700.1 | upstream_gene_variant ; 787.0bp to feature; MODIFIER | silent_mutation | Average:59.892; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0528501350 | G -> A | LOC_Os05g49710.1 | upstream_gene_variant ; 1969.0bp to feature; MODIFIER | silent_mutation | Average:59.892; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0528501350 | G -> A | LOC_Os05g49690.1 | downstream_gene_variant ; 3205.0bp to feature; MODIFIER | silent_mutation | Average:59.892; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0528501350 | G -> A | LOC_Os05g49700-LOC_Os05g49710 | intergenic_region ; MODIFIER | silent_mutation | Average:59.892; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0528501350 | NA | 1.19E-12 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0528501350 | NA | 3.36E-12 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0528501350 | 6.80E-07 | 2.83E-10 | mr1425 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528501350 | NA | 3.59E-06 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528501350 | NA | 4.41E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528501350 | NA | 8.01E-07 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |