\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528501350:

Variant ID: vg0528501350 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28501350
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGTCCTCGTCTACAAGGAACGGCTGCAGGGGCCGACCGCACGTGTCGGGGTGCTCCTCCCCTAACGGAATGCCCAGCTATATCTAGTAGGAATCACCT[G/A]
ATACCTGGTAGGTATCATTCGATACCTCGCAAGTATCACATGATACATGGTAGAAATCGTCTGATACCTGACAAGTATCACATGATACGATACGTGGTAG

Reverse complement sequence

CTACCACGTATCGTATCATGTGATACTTGTCAGGTATCAGACGATTTCTACCATGTATCATGTGATACTTGCGAGGTATCGAATGATACCTACCAGGTAT[C/T]
AGGTGATTCCTACTAGATATAGCTGGGCATTCCGTTAGGGGAGGAGCACCCCGACACGTGCGGTCGGCCCCTGCAGCCGTTCCTTGTAGACGAGGACAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 30.50% 0.06% 0.00% NA
All Indica  2759 60.90% 39.00% 0.11% 0.00% NA
All Japonica  1512 95.50% 4.50% 0.00% 0.00% NA
Aus  269 15.20% 84.80% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 51.20% 48.80% 0.00% 0.00% NA
Indica III  913 40.00% 59.90% 0.11% 0.00% NA
Indica Intermediate  786 64.20% 35.50% 0.25% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 78.80% 21.20% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528501350 G -> A LOC_Os05g49700.1 upstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:59.892; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0528501350 G -> A LOC_Os05g49710.1 upstream_gene_variant ; 1969.0bp to feature; MODIFIER silent_mutation Average:59.892; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0528501350 G -> A LOC_Os05g49690.1 downstream_gene_variant ; 3205.0bp to feature; MODIFIER silent_mutation Average:59.892; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0528501350 G -> A LOC_Os05g49700-LOC_Os05g49710 intergenic_region ; MODIFIER silent_mutation Average:59.892; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528501350 NA 1.19E-12 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528501350 NA 3.36E-12 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528501350 6.80E-07 2.83E-10 mr1425 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528501350 NA 3.59E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528501350 NA 4.41E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528501350 NA 8.01E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251