| Variant ID: vg0528484961 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 28484961 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 124. )
ACCCTCAACTTAACAGCGAGATTTTTGGATGTCCTTTAACCGCAAAATCAGAAATCTTCACCCCTAAACTATACAAAACCGTCCAATTTAGGTCCCATGA[C/T]
AGTATATATGCCTAGTTTCGCTGACGTGGCATCCGAGTCAGCAAAAAAAAAATAAAAAAATATGTGGGTCCCATATGTAAGTGAAATGAGATAGAAAATG
CATTTTCTATCTCATTTCACTTACATATGGGACCCACATATTTTTTTATTTTTTTTTTGCTGACTCGGATGCCACGTCAGCGAAACTAGGCATATATACT[G/A]
TCATGGGACCTAAATTGGACGGTTTTGTATAGTTTAGGGGTGAAGATTTCTGATTTTGCGGTTAAAGGACATCCAAAAATCTCGCTGTTAAGTTGAGGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.70% | 17.40% | 0.93% | 0.00% | NA |
| All Indica | 2759 | 89.10% | 9.50% | 1.41% | 0.00% | NA |
| All Japonica | 1512 | 64.40% | 35.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.40% | 9.10% | 4.54% | 0.00% | NA |
| Indica II | 465 | 80.60% | 18.30% | 1.08% | 0.00% | NA |
| Indica III | 913 | 93.40% | 6.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 91.10% | 8.10% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.40% | 94.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 18.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0528484961 | C -> T | LOC_Os05g49640.1 | upstream_gene_variant ; 4574.0bp to feature; MODIFIER | silent_mutation | Average:59.275; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0528484961 | C -> T | LOC_Os05g49650.1 | upstream_gene_variant ; 2056.0bp to feature; MODIFIER | silent_mutation | Average:59.275; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0528484961 | C -> T | LOC_Os05g49660.1 | upstream_gene_variant ; 1063.0bp to feature; MODIFIER | silent_mutation | Average:59.275; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0528484961 | C -> T | LOC_Os05g49670.1 | upstream_gene_variant ; 2282.0bp to feature; MODIFIER | silent_mutation | Average:59.275; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0528484961 | C -> T | LOC_Os05g49650.2 | upstream_gene_variant ; 2056.0bp to feature; MODIFIER | silent_mutation | Average:59.275; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0528484961 | C -> T | LOC_Os05g49650.3 | upstream_gene_variant ; 2056.0bp to feature; MODIFIER | silent_mutation | Average:59.275; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0528484961 | C -> T | LOC_Os05g49680.1 | downstream_gene_variant ; 4775.0bp to feature; MODIFIER | silent_mutation | Average:59.275; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0528484961 | C -> T | LOC_Os05g49650-LOC_Os05g49660 | intergenic_region ; MODIFIER | silent_mutation | Average:59.275; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0528484961 | NA | 6.86E-16 | mr1115 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528484961 | NA | 2.28E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528484961 | NA | 9.90E-12 | mr1920 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528484961 | NA | 1.50E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528484961 | NA | 5.61E-09 | mr1454_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528484961 | NA | 2.11E-06 | mr1492_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528484961 | NA | 1.60E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528484961 | NA | 5.92E-08 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528484961 | NA | 3.01E-08 | mr1879_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |