RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0528462620:

Variant ID: vg0528462620 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 28462620
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATGTCGAACACTGGAGACAACGGCAACACTGGATACAAGGAGAAGGAGGCTCCCGTCAACACCAACGGAGGCAATACTGCCTCAAACTCCAGCGGAG[G/A]
ACCATGCTTGGGGTATAACCTTCTTACATTATTTCAATTAGAAGTTTTACTGTTAATGTTCATCGCAATGTCAACATTGTGTTATTATGTGATTGTTGAT

Reverse complement sequence

ATCAACAATCACATAATAACACAATGTTGACATTGCGATGAACATTAACAGTAAAACTTCTAATTGAAATAATGTAAGAAGGTTATACCCCAAGCATGGT[C/T]
CTCCGCTGGAGTTTGAGGCAGTATTGCCTCCGTTGGTGTTGACGGGAGCCTCCTTCTCCTTGTATCCAGTGTTGCCGTTGTCTCCAGTGTTCGACATATT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	6.30%	0.04%	0.00%	NA
All Indica	2759	97.80%	2.20%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	14.10%	85.50%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	94.10%	5.90%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0528462620	G -> A	LOC_Os05g49610.1	upstream_gene_variant ; 1480.0bp to feature; MODIFIER	silent_mutation	Average:18.112; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0528462620	G -> A	LOC_Os05g49600.1	downstream_gene_variant ; 1289.0bp to feature; MODIFIER	silent_mutation	Average:18.112; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0528462620	G -> A	LOC_Os05g49600-LOC_Os05g49610	intergenic_region ; MODIFIER	silent_mutation	Average:18.112; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0528462620	3.54E-06	8.34E-09	mr1004	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528462620	NA	3.78E-07	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528462620	1.98E-06	NA	mr1010	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528462620	NA	2.21E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528462620	NA	5.34E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528462620	NA	3.04E-07	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528462620	NA	6.14E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528462620	NA	4.18E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528462620	NA	2.43E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528462620	NA	1.05E-25	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 85 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0528462620:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact