\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528326098:

Variant ID: vg0528326098 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28326098
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATCTCTCGTGTGATTTTTTTCTTCGTATTTGACGTTTTTTCAACCGTCGGATCTGCACCGCGATTAGGCGCGACGAATCAGACACGCACAAAGTGGTC[C/T]
AGCGCCACACGTCTCACGGGCGACATGGTGGAGGAAACGATCGATAAGCTGATAGTAACACAGTAGACAGTAGCCAGTAGCCGGAGTATCTCAGCTTCCA

Reverse complement sequence

TGGAAGCTGAGATACTCCGGCTACTGGCTACTGTCTACTGTGTTACTATCAGCTTATCGATCGTTTCCTCCACCATGTCGCCCGTGAGACGTGTGGCGCT[G/A]
GACCACTTTGTGCGTGTCTGATTCGTCGCGCCTAATCGCGGTGCAGATCCGACGGTTGAAAAAACGTCAAATACGAAGAAAAAAATCACACGAGAGATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 3.70% 7.60% 9.50% NA
All Indica  2759 88.80% 2.40% 6.56% 2.25% NA
All Japonica  1512 72.00% 0.00% 4.96% 23.08% NA
Aus  269 23.80% 40.10% 33.09% 2.97% NA
Indica I  595 76.60% 5.90% 13.78% 3.70% NA
Indica II  465 95.10% 0.40% 2.37% 2.15% NA
Indica III  913 94.40% 0.40% 4.05% 1.10% NA
Indica Intermediate  786 87.90% 3.10% 6.49% 2.54% NA
Temperate Japonica  767 98.00% 0.00% 0.00% 1.96% NA
Tropical Japonica  504 37.70% 0.00% 12.30% 50.00% NA
Japonica Intermediate  241 60.60% 0.00% 5.39% 34.02% NA
VI/Aromatic  96 65.60% 1.00% 11.46% 21.88% NA
Intermediate  90 84.40% 2.20% 3.33% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528326098 C -> T LOC_Os05g49390.1 upstream_gene_variant ; 201.0bp to feature; MODIFIER silent_mutation Average:94.875; most accessible tissue: Minghui63 flag leaf, score: 99.154 N N N N
vg0528326098 C -> T LOC_Os05g49400.1 upstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:94.875; most accessible tissue: Minghui63 flag leaf, score: 99.154 N N N N
vg0528326098 C -> T LOC_Os05g49410.1 upstream_gene_variant ; 3324.0bp to feature; MODIFIER silent_mutation Average:94.875; most accessible tissue: Minghui63 flag leaf, score: 99.154 N N N N
vg0528326098 C -> T LOC_Os05g49410.2 upstream_gene_variant ; 3273.0bp to feature; MODIFIER silent_mutation Average:94.875; most accessible tissue: Minghui63 flag leaf, score: 99.154 N N N N
vg0528326098 C -> T LOC_Os05g49390-LOC_Os05g49400 intergenic_region ; MODIFIER silent_mutation Average:94.875; most accessible tissue: Minghui63 flag leaf, score: 99.154 N N N N
vg0528326098 C -> DEL N N silent_mutation Average:94.875; most accessible tissue: Minghui63 flag leaf, score: 99.154 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0528326098 C T -0.19 -0.26 -0.21 -0.13 -0.19 -0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528326098 NA 3.30E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 4.26E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.08E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.86E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 5.89E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.78E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.42E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.59E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.52E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.32E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 5.31E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.57E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.34E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 1.20E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 5.38E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.21E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 1.86E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 1.96E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 6.50E-08 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 9.41E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 8.72E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 6.88E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 2.30E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 1.19E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 1.74E-06 2.78E-11 mr1931 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 4.32E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528326098 NA 6.81E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251