\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528325523:

Variant ID: vg0528325523 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28325523
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CCGCGACGAATGGTGGTTGACGTGGGATAGATGCACGTGGAGGCGAACGCTTCCTGCTAGTTGCTATGAACTGCTGCTGCTTCATACTTCCTCCGATTAA[C/T]
AATATAAGACTTTATAGGATTGCTCATATTTATATAGATATTAATGAATCTAGACATATATATGCATCTAGATTCAGTAACATCTAGTATATGAATATGA

Reverse complement sequence

TCATATTCATATACTAGATGTTACTGAATCTAGATGCATATATATGTCTAGATTCATTAATATCTATATAAATATGAGCAATCCTATAAAGTCTTATATT[G/A]
TTAATCGGAGGAAGTATGAAGCAGCAGCAGTTCATAGCAACTAGCAGGAAGCGTTCGCCTCCACGTGCATCTATCCCACGTCAACCACCATTCGTCGCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 2.10% 1.21% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 91.40% 5.00% 3.64% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 88.40% 6.30% 5.35% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 83.80% 10.40% 5.81% 0.00% NA
VI/Aromatic  96 78.10% 20.80% 1.04% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528325523 C -> T LOC_Os05g49400.1 upstream_gene_variant ; 1896.0bp to feature; MODIFIER silent_mutation Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217 N N N N
vg0528325523 C -> T LOC_Os05g49410.1 upstream_gene_variant ; 3899.0bp to feature; MODIFIER silent_mutation Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217 N N N N
vg0528325523 C -> T LOC_Os05g49410.2 upstream_gene_variant ; 3848.0bp to feature; MODIFIER silent_mutation Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217 N N N N
vg0528325523 C -> T LOC_Os05g49390.1 intron_variant ; MODIFIER silent_mutation Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528325523 1.88E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528325523 NA 1.66E-14 Plant_height Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528325523 NA 2.05E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523 NA 2.56E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523 NA 2.71E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523 NA 8.79E-06 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523 NA 9.58E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523 NA 1.78E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523 NA 2.03E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523 NA 5.32E-07 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251