| Variant ID: vg0528218584 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 28218584 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 304. )
TCGATATGAAGTTGAGATCTAGCAAATCATTTTATATAAATCGTTATGCAGGATTTCTTTTTAATCATACGAGAAATAGGATCTTGCATAGCCTGATCAA[T/C]
TTAGGGGTAGCACTGATTAATATTTTTCCGGATTTTAATACTTCCTGGTTTGATTTAGTTTTTTTATCCACAAGGCTACAAATGTTGGTATGTTCGGCAA
TTGCCGAACATACCAACATTTGTAGCCTTGTGGATAAAAAAACTAAATCAAACCAGGAAGTATTAAAATCCGGAAAAATATTAATCAGTGCTACCCCTAA[A/G]
TTGATCAGGCTATGCAAGATCCTATTTCTCGTATGATTAAAAAGAAATCCTGCATAACGATTTATATAAAATGATTTGCTAGATCTCAACTTCATATCGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 8.30% | 1.10% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 72.60% | 24.20% | 3.24% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 57.10% | 37.50% | 5.35% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.40% | 30.30% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0528218584 | T -> C | LOC_Os05g49170.1 | upstream_gene_variant ; 2539.0bp to feature; MODIFIER | silent_mutation | Average:51.637; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0528218584 | T -> C | LOC_Os05g49180.1 | upstream_gene_variant ; 1524.0bp to feature; MODIFIER | silent_mutation | Average:51.637; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0528218584 | T -> C | LOC_Os05g49170-LOC_Os05g49180 | intergenic_region ; MODIFIER | silent_mutation | Average:51.637; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0528218584 | 3.87E-06 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528218584 | 1.39E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528218584 | 7.75E-08 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528218584 | NA | 3.72E-06 | mr1092_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528218584 | NA | 1.46E-07 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528218584 | 1.51E-08 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528218584 | 4.78E-06 | 7.63E-08 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528218584 | NA | 5.79E-08 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528218584 | 3.84E-06 | 3.84E-06 | mr1806_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528218584 | 3.06E-07 | NA | mr1959_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/