Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528196605:

Variant ID: vg0528196605 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 28196605
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

GGAATGGGTATTTTCATCCATTAGACCCGATTCTCGCGGGAAGGATATGGGAGAGAAAAATAAGAATATCCTTCTATCCGAGGATATAGAGAGTTGTATC[C/T]
GTCCGTATCTCTCATATTATCAAATATATATGAAATATATTATAAATGCATCTATAAACATGATAAAAGATTCGTTAGCACTATTTTACGAGCTCACAAG

Reverse complement sequence

CTTGTGAGCTCGTAAAATAGTGCTAACGAATCTTTTATCATGTTTATAGATGCATTTATAATATATTTCATATATATTTGATAATATGAGAGATACGGAC[G/A]
GATACAACTCTCTATATCCTCGGATAGAAGGATATTCTTATTTTTCTCTCCCATATCCTTCCCGCGAGAATCGGGTCTAATGGATGAAAATACCCATTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.00%	16.50%	3.43%	0.00%	NA
All Indica	2759	86.50%	7.90%	5.58%	0.00%	NA
All Japonica	1512	64.30%	35.30%	0.40%	0.00%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	86.20%	3.70%	10.08%	0.00%	NA
Indica II	465	66.70%	27.30%	6.02%	0.00%	NA
Indica III	913	98.40%	0.90%	0.77%	0.00%	NA
Indica Intermediate	786	84.60%	7.90%	7.51%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	4.60%	94.80%	0.60%	0.00%	NA
Japonica Intermediate	241	78.00%	20.70%	1.24%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0528196605	C -> T	LOC_Os05g49140.1	upstream_gene_variant ; 2580.0bp to feature; MODIFIER	silent_mutation	Average:52.215; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0528196605	C -> T	LOC_Os05g49140.2	upstream_gene_variant ; 3798.0bp to feature; MODIFIER	silent_mutation	Average:52.215; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0528196605	C -> T	LOC_Os05g49140.3	upstream_gene_variant ; 2583.0bp to feature; MODIFIER	silent_mutation	Average:52.215; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0528196605	C -> T	LOC_Os05g49140-LOC_Os05g49150	intergenic_region ; MODIFIER	silent_mutation	Average:52.215; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0528196605	NA	4.15E-12	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	7.72E-13	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	7.07E-13	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	8.84E-13	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	3.50E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	5.70E-13	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	6.00E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	7.20E-06	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	3.22E-06	8.02E-07	mr1270_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	6.45E-06	mr1316_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	2.62E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	3.04E-10	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	5.06E-07	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	8.45E-13	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	NA	5.65E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528196605	2.66E-08	1.65E-07	mr1932_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251