Variant ID: vg0528104538 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 28104538 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAAAGTTTGGTTTGAAAATACAATTCCTTGCAAGCTGCAGGGCTGTTGGATGCTGGGTTGCTGCAGGGAGGGGCGGCGCCGCCGCCGCCCTCGGCGACG[G/A]
TGGTGGCGGTGAGCCGCGACGACGAGACGATGTGCACCAAGACCACGAGCTACAGCTTCCCGGCGACGATGCACCTCAACGTGAAGATGTTCGGCGAGGC
GCCTCGCCGAACATCTTCACGTTGAGGTGCATCGTCGCCGGGAAGCTGTAGCTCGTGGTCTTGGTGCACATCGTCTCGTCGTCGCGGCTCACCGCCACCA[C/T]
CGTCGCCGAGGGCGGCGGCGGCGCCGCCCCTCCCTGCAGCAACCCAGCATCCAACAGCCCTGCAGCTTGCAAGGAATTGTATTTTCAAACCAAACTTTAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.60% | 6.10% | 0.32% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 80.20% | 18.80% | 0.99% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 67.00% | 31.20% | 1.83% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 82.20% | 17.40% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0528104538 | G -> A | LOC_Os05g48990.1 | missense_variant ; p.Val443Met; MODERATE | nonsynonymous_codon ; V443M | Average:53.147; most accessible tissue: Minghui63 panicle, score: 70.194 | unknown | unknown | TOLERATED | 0.12 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0528104538 | NA | 1.09E-13 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0528104538 | NA | 2.34E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0528104538 | NA | 1.90E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0528104538 | NA | 5.43E-06 | mr1092 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528104538 | NA | 2.98E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528104538 | 6.28E-07 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528104538 | 3.78E-09 | NA | mr1310 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528104538 | 1.98E-10 | NA | mr1926 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528104538 | NA | 1.14E-06 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528104538 | NA | 2.94E-06 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/