Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0528063279:

Variant ID: vg0528063279 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 28063279
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

GAATGCGGGATGTTCATCGAATATACTTATGTTGATGGCTTCATCATGTTCCGCTGCCCCCTTTTCACAAAGGGGCACAGGGATGTCACTCGCCGTGGTC[G/A]
GGCCATTGGTCATCACTTGGCCGACGCGGCGCTCCACGGTTTCGCCGCTCAGACCTGTTAATTAAGAACCAACCTTTGATAAGTCAAGAGGAATGCGAAC

Reverse complement sequence

GTTCGCATTCCTCTTGACTTATCAAAGGTTGGTTCTTAATTAACAGGTCTGAGCGGCGAAACCGTGGAGCGCCGCGTCGGCCAAGTGATGACCAATGGCC[C/T]
GACCACGGCGAGTGACATCCCTGTGCCCCTTTGTGAAAAGGGGGCAGCGGAACATGATGAAGCCATCAACATAAGTATATTCGATGAACATCCCGCATTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	21.20%	0.04%	0.21%	NA
All Indica	2759	99.20%	0.80%	0.00%	0.00%	NA
All Japonica	1512	40.10%	59.20%	0.00%	0.66%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	2.90%	97.10%	0.00%	0.00%	NA
Tropical Japonica	504	95.60%	2.40%	0.00%	1.98%	NA
Japonica Intermediate	241	42.70%	57.30%	0.00%	0.00%	NA
VI/Aromatic	96	30.20%	69.80%	0.00%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0528063279	G -> DEL	N	N	silent_mutation	Average:23.121; most accessible tissue: Callus, score: 43.54	N	N	N	N
vg0528063279	G -> A	LOC_Os05g48920.1	upstream_gene_variant ; 186.0bp to feature; MODIFIER	silent_mutation	Average:23.121; most accessible tissue: Callus, score: 43.54	N	N	N	N
vg0528063279	G -> A	LOC_Os05g48930.1	upstream_gene_variant ; 4559.0bp to feature; MODIFIER	silent_mutation	Average:23.121; most accessible tissue: Callus, score: 43.54	N	N	N	N
vg0528063279	G -> A	LOC_Os05g48910.1	downstream_gene_variant ; 194.0bp to feature; MODIFIER	silent_mutation	Average:23.121; most accessible tissue: Callus, score: 43.54	N	N	N	N
vg0528063279	G -> A	LOC_Os05g48910-LOC_Os05g48920	intergenic_region ; MODIFIER	silent_mutation	Average:23.121; most accessible tissue: Callus, score: 43.54	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0528063279	NA	1.45E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	1.52E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	2.79E-07	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	3.16E-12	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	1.53E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	1.67E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	1.90E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	9.46E-10	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	7.20E-06	mr1782_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	1.25E-10	mr1879_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528063279	NA	9.16E-07	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251