Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528032302:

Variant ID: vg0528032302 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 28032302
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCGTAGGTTGGTCGGCACAAATCCCAGTCTACTCACAGTAATCCCTAGTAGAGCAAGTTTAATAGTATAGCTAATTACTAACTTTAAATTATCTATA[G/A]
TCAATTTAATAGCCAATTCATATACAATAGTTACCTATAAACATATTAATATCCGGTCCCACCTATCATACTCACATTGTGTTTTAGAGTCCGTGCTGCA

Reverse complement sequence

TGCAGCACGGACTCTAAAACACAATGTGAGTATGATAGGTGGGACCGGATATTAATATGTTTATAGGTAACTATTGTATATGAATTGGCTATTAAATTGA[C/T]
TATAGATAATTTAAAGTTAGTAATTAGCTATACTATTAAACTTGCTCTACTAGGGATTACTGTGAGTAGACTGGGATTTGTGCCGACCAACCTACGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	32.60%	0.19%	0.00%	NA
All Indica	2759	48.30%	51.50%	0.18%	0.00%	NA
All Japonica	1512	94.40%	5.40%	0.13%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	4.50%	95.30%	0.17%	0.00%	NA
Indica II	465	76.80%	23.20%	0.00%	0.00%	NA
Indica III	913	66.30%	33.60%	0.11%	0.00%	NA
Indica Intermediate	786	43.80%	55.90%	0.38%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	74.70%	24.50%	0.83%	0.00%	NA
VI/Aromatic	96	86.50%	12.50%	1.04%	0.00%	NA
Intermediate	90	71.10%	27.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0528032302	G -> A	LOC_Os05g48870.1	upstream_gene_variant ; 2078.0bp to feature; MODIFIER	silent_mutation	Average:81.256; most accessible tissue: Minghui63 young leaf, score: 94.723	N	N	N	N
vg0528032302	G -> A	LOC_Os05g48860-LOC_Os05g48870	intergenic_region ; MODIFIER	silent_mutation	Average:81.256; most accessible tissue: Minghui63 young leaf, score: 94.723	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0528032302	G	A	-0.02	0.0	0.01	0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0528032302	NA	3.06E-08	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	1.48E-16	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	4.65E-11	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	1.70E-15	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	9.83E-10	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	3.44E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	4.11E-15	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	5.85E-10	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	5.11E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	2.37E-07	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	3.82E-08	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	4.64E-06	1.45E-09	mr1835	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	6.68E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	1.58E-09	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	2.74E-10	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528032302	NA	5.65E-08	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251