\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527972045:

Variant ID: vg0527972045 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 27972045
Reference Allele: AAlternative Allele: G,ATGCAAACAG,ACTAG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, C: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


CTAACTTTAATCTACGGGGCCATGACCGGAGTTGGGTGCAAAAGCACTGATAAGCCTACTACCATTCTTTAACCCACTCCTAAATTAAACCCTCTAACTA[A/G,ATGCAAACAG,ACTAG]
GGATGCAAACGGACCGACCCACGAATTTACTTATAGGTCAAATACTAGATGATAACCGCATCTAAATATGCAAGTGGGTCAATATATACTCATTTTTAGG

Reverse complement sequence

CCTAAAAATGAGTATATATTGACCCACTTGCATATTTAGATGCGGTTATCATCTAGTATTTGACCTATAAGTAAATTCGTGGGTCGGTCCGTTTGCATCC[T/C,CTGTTTGCAT,CTAGT]
TAGTTAGAGGGTTTAATTTAGGAGTGGGTTAAAGAATGGTAGTAGGCTTATCAGTGCTTTTGCACCCAACTCCGGTCATGGCCCCGTAGATTAAAGTTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 26.00% 0.11% 0.00% ATGCAAACAG: 6.20%; ACTAG: 0.04%
All Indica  2759 92.50% 6.10% 0.07% 0.00% ATGCAAACAG: 1.38%
All Japonica  1512 36.20% 63.80% 0.00% 0.00% NA
Aus  269 5.90% 1.10% 0.74% 0.00% ATGCAAACAG: 92.19%
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 75.50% 24.30% 0.00% 0.00% ATGCAAACAG: 0.22%
Indica III  913 99.00% 0.20% 0.00% 0.00% ATGCAAACAG: 0.77%
Indica Intermediate  786 90.50% 5.50% 0.25% 0.00% ATGCAAACAG: 3.82%
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 86.50% 13.50% 0.00% 0.00% NA
Japonica Intermediate  241 38.60% 61.40% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 76.00% 0.00% 0.00% ATGCAAACAG: 2.08%
Intermediate  90 68.90% 22.20% 1.11% 0.00% ATGCAAACAG: 5.56%; ACTAG: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527972045 A -> ATGCAAACAG LOC_Os05g48800.1 upstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ATGCAAACAG LOC_Os05g48800.2 upstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ATGCAAACAG LOC_Os05g48800.3 upstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ATGCAAACAG LOC_Os05g48810.1 downstream_gene_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ATGCAAACAG LOC_Os05g48820.1 downstream_gene_variant ; 3610.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ATGCAAACAG LOC_Os05g48800-LOC_Os05g48810 intergenic_region ; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> G LOC_Os05g48800.1 upstream_gene_variant ; 957.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> G LOC_Os05g48800.2 upstream_gene_variant ; 957.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> G LOC_Os05g48800.3 upstream_gene_variant ; 957.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> G LOC_Os05g48810.1 downstream_gene_variant ; 246.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> G LOC_Os05g48820.1 downstream_gene_variant ; 3611.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> G LOC_Os05g48800-LOC_Os05g48810 intergenic_region ; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ACTAG LOC_Os05g48800.1 upstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ACTAG LOC_Os05g48800.2 upstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ACTAG LOC_Os05g48800.3 upstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ACTAG LOC_Os05g48810.1 downstream_gene_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ACTAG LOC_Os05g48820.1 downstream_gene_variant ; 3610.0bp to feature; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0527972045 A -> ACTAG LOC_Os05g48800-LOC_Os05g48810 intergenic_region ; MODIFIER silent_mutation Average:82.229; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0527972045 A ACTAG 0.03 0.01 0.02 0.05 0.01 -0.05
vg0527972045 A ATGCA* -0.41 -0.21 -0.09 -0.05 -0.27 -0.44
vg0527972045 A G -0.05 0.01 0.02 0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527972045 NA 8.79E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 2.64E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 6.04E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 9.46E-07 NA mr1940 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 6.44E-20 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 4.70E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 1.31E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 9.76E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 1.42E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 4.98E-08 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 1.49E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 5.43E-07 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 1.76E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 8.99E-11 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 6.38E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 5.78E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 1.35E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 1.03E-07 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 1.56E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 1.81E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 2.03E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527972045 NA 1.11E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251