\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527948989:

Variant ID: vg0527948989 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27948989
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


CATCCCACTAAAATCCTTTATATTTTAGGACGGAGGGAATATCGCGAACAATACTGCGACATAGGTGTCATTGTGTTATAGATGTCTCATCATTGGACTT[C/T]
ATCTTCCAAATCCAAATGGTTGTACACTGAATAGATTCCTATTGCCCCCACAAAAGTATGACAGACTGCATAGCATTCTGTATAAAGACAATTATTAAAT

Reverse complement sequence

ATTTAATAATTGTCTTTATACAGAATGCTATGCAGTCTGTCATACTTTTGTGGGGGCAATAGGAATCTATTCAGTGTACAACCATTTGGATTTGGAAGAT[G/A]
AAGTCCAATGATGAGACATCTATAACACAATGACACCTATGTCGCAGTATTGTTCGCGATATTCCCTCCGTCCTAAAATATAAAGGATTTTAGTGGGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.30% 40.50% 0.21% 0.00% NA
All Indica  2759 57.80% 42.10% 0.07% 0.00% NA
All Japonica  1512 70.30% 29.30% 0.40% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 93.40% 6.60% 0.00% 0.00% NA
Indica II  465 47.70% 52.30% 0.00% 0.00% NA
Indica III  913 36.50% 63.40% 0.11% 0.00% NA
Indica Intermediate  786 61.70% 38.20% 0.13% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 18.10% 81.30% 0.60% 0.00% NA
Japonica Intermediate  241 88.40% 10.40% 1.24% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527948989 C -> T LOC_Os05g48760.1 downstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:92.274; most accessible tissue: Zhenshan97 flag leaf, score: 97.348 N N N N
vg0527948989 C -> T LOC_Os05g48770.1 downstream_gene_variant ; 2066.0bp to feature; MODIFIER silent_mutation Average:92.274; most accessible tissue: Zhenshan97 flag leaf, score: 97.348 N N N N
vg0527948989 C -> T LOC_Os05g48760-LOC_Os05g48770 intergenic_region ; MODIFIER silent_mutation Average:92.274; most accessible tissue: Zhenshan97 flag leaf, score: 97.348 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0527948989 C T 0.0 -0.01 0.01 0.0 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527948989 NA 3.77E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 2.13E-10 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 3.79E-09 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 1.89E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 1.95E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 9.10E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 1.07E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 1.46E-08 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 6.84E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 8.26E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 4.60E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 5.44E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 5.73E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 2.06E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 NA 7.68E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527948989 2.38E-06 2.37E-06 mr1919_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251