\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527926912:

Variant ID: vg0527926912 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27926912
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCTCCATCTCCCTCTTCATCTGCTAGTATGTTTAAATCTATAGCCATTGTGATTTGTGGGCATGGAGTTGCTTTGCAAGCTGATCAATGGAATGGGAAG[T/C]
GACTGGTTGACTGGCTCCTTGAGGATTTGTAGGGAATGGAGGGGCACCCTTTGGCGGCAAAGTAGCATATGTTTGTAGTATTTTGAATTCAAGGGCTTGT

Reverse complement sequence

ACAAGCCCTTGAATTCAAAATACTACAAACATATGCTACTTTGCCGCCAAAGGGTGCCCCTCCATTCCCTACAAATCCTCAAGGAGCCAGTCAACCAGTC[A/G]
CTTCCCATTCCATTGATCAGCTTGCAAAGCAACTCCATGCCCACAAATCACAATGGCTATAGATTTAAACATACTAGCAGATGAAGAGGGAGATGGAGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.60% 27.50% 6.58% 32.33% NA
All Indica  2759 44.40% 7.40% 8.45% 39.76% NA
All Japonica  1512 14.10% 64.30% 3.44% 18.19% NA
Aus  269 43.10% 4.80% 5.20% 46.84% NA
Indica I  595 21.50% 2.90% 6.39% 69.24% NA
Indica II  465 33.30% 25.40% 6.45% 34.84% NA
Indica III  913 66.30% 0.90% 8.00% 24.86% NA
Indica Intermediate  786 43.00% 7.60% 11.70% 37.66% NA
Temperate Japonica  767 1.00% 97.50% 0.26% 1.17% NA
Tropical Japonica  504 26.80% 14.10% 8.93% 50.20% NA
Japonica Intermediate  241 29.00% 63.50% 2.07% 5.39% NA
VI/Aromatic  96 5.20% 86.50% 1.04% 7.29% NA
Intermediate  90 30.00% 32.20% 12.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527926912 T -> DEL N N silent_mutation Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0527926912 T -> C LOC_Os05g48720.1 upstream_gene_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0527926912 T -> C LOC_Os05g48730.1 upstream_gene_variant ; 2112.0bp to feature; MODIFIER silent_mutation Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0527926912 T -> C LOC_Os05g48710.1 downstream_gene_variant ; 3168.0bp to feature; MODIFIER silent_mutation Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0527926912 T -> C LOC_Os05g48720-LOC_Os05g48730 intergenic_region ; MODIFIER silent_mutation Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527926912 NA 2.76E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 2.90E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 2.58E-19 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 6.77E-07 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 6.43E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 1.64E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 1.90E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 3.99E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 4.51E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 7.41E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 1.56E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 1.43E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 6.37E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 3.36E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 9.53E-07 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 4.21E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 1.12E-06 2.27E-07 mr1689_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 2.96E-10 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 4.47E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 6.05E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 6.76E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 1.31E-07 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 4.54E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 5.15E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912 NA 2.52E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251