Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527926912:

Variant ID: vg0527926912 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27926912
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCTCCATCTCCCTCTTCATCTGCTAGTATGTTTAAATCTATAGCCATTGTGATTTGTGGGCATGGAGTTGCTTTGCAAGCTGATCAATGGAATGGGAAG[T/C]
GACTGGTTGACTGGCTCCTTGAGGATTTGTAGGGAATGGAGGGGCACCCTTTGGCGGCAAAGTAGCATATGTTTGTAGTATTTTGAATTCAAGGGCTTGT

Reverse complement sequence

ACAAGCCCTTGAATTCAAAATACTACAAACATATGCTACTTTGCCGCCAAAGGGTGCCCCTCCATTCCCTACAAATCCTCAAGGAGCCAGTCAACCAGTC[A/G]
CTTCCCATTCCATTGATCAGCTTGCAAAGCAACTCCATGCCCACAAATCACAATGGCTATAGATTTAAACATACTAGCAGATGAAGAGGGAGATGGAGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.60%	27.50%	6.58%	32.33%	NA
All Indica	2759	44.40%	7.40%	8.45%	39.76%	NA
All Japonica	1512	14.10%	64.30%	3.44%	18.19%	NA
Aus	269	43.10%	4.80%	5.20%	46.84%	NA
Indica I	595	21.50%	2.90%	6.39%	69.24%	NA
Indica II	465	33.30%	25.40%	6.45%	34.84%	NA
Indica III	913	66.30%	0.90%	8.00%	24.86%	NA
Indica Intermediate	786	43.00%	7.60%	11.70%	37.66%	NA
Temperate Japonica	767	1.00%	97.50%	0.26%	1.17%	NA
Tropical Japonica	504	26.80%	14.10%	8.93%	50.20%	NA
Japonica Intermediate	241	29.00%	63.50%	2.07%	5.39%	NA
VI/Aromatic	96	5.20%	86.50%	1.04%	7.29%	NA
Intermediate	90	30.00%	32.20%	12.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527926912	T -> DEL	N	N	silent_mutation	Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0527926912	T -> C	LOC_Os05g48720.1	upstream_gene_variant ; 53.0bp to feature; MODIFIER	silent_mutation	Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0527926912	T -> C	LOC_Os05g48730.1	upstream_gene_variant ; 2112.0bp to feature; MODIFIER	silent_mutation	Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0527926912	T -> C	LOC_Os05g48710.1	downstream_gene_variant ; 3168.0bp to feature; MODIFIER	silent_mutation	Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0527926912	T -> C	LOC_Os05g48720-LOC_Os05g48730	intergenic_region ; MODIFIER	silent_mutation	Average:25.296; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527926912	NA	2.76E-24	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	2.90E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	2.58E-19	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	6.77E-07	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	6.43E-07	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	1.64E-07	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	1.90E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	3.99E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	4.51E-08	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	7.41E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	1.56E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	1.43E-10	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	6.37E-06	mr1636_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	3.36E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	9.53E-07	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	4.21E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	1.12E-06	2.27E-07	mr1689_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	2.96E-10	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	4.47E-06	mr1747_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	6.05E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	6.76E-11	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	1.31E-07	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	4.54E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	5.15E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527926912	NA	2.52E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251