\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527925493:

Variant ID: vg0527925493 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27925493
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACATTGAACACTTCAGCAACTACACGTGTGCTGCCTTTTTCTAGGTATCCATCCAGACTTTTTGTAAGCAACAATTCATAAATGCTTCGCCTTTGTGG[G/A]
TTTGTCAATTCTCTGGCATTGATTGGCTCATTTGCATTTGCATCATTTTCTTCTTCATCTGAGTCGGGCAACTCCTCTTTCTTCGAGCACAACATTGATA

Reverse complement sequence

TATCAATGTTGTGCTCGAAGAAAGAGGAGTTGCCCGACTCAGATGAAGAAGAAAATGATGCAAATGCAAATGAGCCAATCAATGCCAGAGAATTGACAAA[C/T]
CCACAAAGGCGAAGCATTTATGAATTGTTGCTTACAAAAAGTCTGGATGGATACCTAGAAAAAGGCAGCACACGTGTAGTTGCTGAAGTGTTCAATGTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.80% 0.30% 14.47% 57.41% NA
All Indica  2759 7.70% 0.50% 16.93% 74.81% NA
All Japonica  1512 64.50% 0.00% 7.61% 27.91% NA
Aus  269 5.20% 0.00% 32.71% 62.08% NA
Indica I  595 3.40% 0.30% 18.99% 77.31% NA
Indica II  465 24.90% 0.20% 8.17% 66.67% NA
Indica III  913 1.60% 0.80% 16.87% 80.72% NA
Indica Intermediate  786 7.90% 0.60% 20.61% 70.87% NA
Temperate Japonica  767 97.70% 0.00% 0.52% 1.83% NA
Tropical Japonica  504 14.50% 0.00% 11.31% 74.21% NA
Japonica Intermediate  241 63.50% 0.00% 22.41% 14.11% NA
VI/Aromatic  96 86.50% 0.00% 2.08% 11.46% NA
Intermediate  90 32.20% 0.00% 13.33% 54.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527925493 G -> DEL N N silent_mutation Average:9.278; most accessible tissue: Callus, score: 32.401 N N N N
vg0527925493 G -> A LOC_Os05g48730.1 upstream_gene_variant ; 3531.0bp to feature; MODIFIER silent_mutation Average:9.278; most accessible tissue: Callus, score: 32.401 N N N N
vg0527925493 G -> A LOC_Os05g48710.1 downstream_gene_variant ; 1749.0bp to feature; MODIFIER silent_mutation Average:9.278; most accessible tissue: Callus, score: 32.401 N N N N
vg0527925493 G -> A LOC_Os05g48720.1 intron_variant ; MODIFIER silent_mutation Average:9.278; most accessible tissue: Callus, score: 32.401 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527925493 NA 6.05E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 1.91E-06 mr1115_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 7.88E-20 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 6.85E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 6.32E-07 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 2.71E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 7.52E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 7.57E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 1.27E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 1.32E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 2.37E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 9.78E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 1.05E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 1.07E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 2.12E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 6.61E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 1.19E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 2.10E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 2.78E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 1.54E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 7.94E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 1.09E-14 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 7.85E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527925493 NA 3.64E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251