\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527902831:

Variant ID: vg0527902831 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27902831
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCACATCAAAATTTAAAGTTTGGTTGAAATTGGAACGATGAGACGGAAAGTTGGAAGTTTGTGTGTATAGAAAAGTTTTTGATATGATGGAAAAGTTG[G/A]
AAGTTTGAAGAAAAAGTTTGGAACTAAACAAGGGCTTAGCCAAAAACTGTTACTGATCTGAATTTGCTTCGTTGCTAGTCGCCCTGTGCATGTGCTCCGC

Reverse complement sequence

GCGGAGCACATGCACAGGGCGACTAGCAACGAAGCAAATTCAGATCAGTAACAGTTTTTGGCTAAGCCCTTGTTTAGTTCCAAACTTTTTCTTCAAACTT[C/T]
CAACTTTTCCATCATATCAAAAACTTTTCTATACACACAAACTTCCAACTTTCCGTCTCATCGTTCCAATTTCAACCAAACTTTAAATTTTGATGTGAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 24.10% 0.04% 0.00% NA
All Indica  2759 63.90% 36.10% 0.04% 0.00% NA
All Japonica  1512 92.50% 7.40% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 17.10% 82.70% 0.17% 0.00% NA
Indica II  465 85.80% 14.20% 0.00% 0.00% NA
Indica III  913 82.80% 17.20% 0.00% 0.00% NA
Indica Intermediate  786 64.20% 35.80% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 92.30% 7.70% 0.00% 0.00% NA
Japonica Intermediate  241 72.60% 27.00% 0.41% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527902831 G -> A LOC_Os05g48690.1 downstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:91.149; most accessible tissue: Zhenshan97 flag leaf, score: 96.336 N N N N
vg0527902831 G -> A LOC_Os05g48690.2 downstream_gene_variant ; 499.0bp to feature; MODIFIER silent_mutation Average:91.149; most accessible tissue: Zhenshan97 flag leaf, score: 96.336 N N N N
vg0527902831 G -> A LOC_Os05g48690-LOC_Os05g48700 intergenic_region ; MODIFIER silent_mutation Average:91.149; most accessible tissue: Zhenshan97 flag leaf, score: 96.336 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0527902831 G A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527902831 NA 2.14E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 2.16E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 1.09E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 7.05E-09 mr1332_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 4.98E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 9.65E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 1.16E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 3.44E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 2.31E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 4.45E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527902831 NA 4.36E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251