\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527829822:

Variant ID: vg0527829822 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27829822
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GCATATGCAGATTAATCAATTATACATGCATACTAGATCAGGATCGACATGTTGGACATGGTAGTTAGCTGCATAGATTAATGGGGTGTTAATATATGAT[T/A]
ATGTGTGCTTTAGTTTCCTGTTGGATGTTGGTTTGTTTTGGTGCAACGCAATGTATCAACAAGGACACAATAGAACAAAGAGAAACGGTCATAGGCGAGG

Reverse complement sequence

CCTCGCCTATGACCGTTTCTCTTTGTTCTATTGTGTCCTTGTTGATACATTGCGTTGCACCAAAACAAACCAACATCCAACAGGAAACTAAAGCACACAT[A/T]
ATCATATATTAACACCCCATTAATCTATGCAGCTAACTACCATGTCCAACATGTCGATCCTGATCTAGTATGCATGTATAATTGATTAATCTGCATATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 38.60% 0.15% 0.00% NA
All Indica  2759 85.00% 14.80% 0.18% 0.00% NA
All Japonica  1512 30.10% 69.80% 0.07% 0.00% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 89.20% 10.10% 0.67% 0.00% NA
Indica II  465 85.40% 14.60% 0.00% 0.00% NA
Indica III  913 89.40% 10.60% 0.00% 0.00% NA
Indica Intermediate  786 76.60% 23.30% 0.13% 0.00% NA
Temperate Japonica  767 2.70% 97.30% 0.00% 0.00% NA
Tropical Japonica  504 78.60% 21.40% 0.00% 0.00% NA
Japonica Intermediate  241 15.80% 83.80% 0.41% 0.00% NA
VI/Aromatic  96 37.50% 61.50% 1.04% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527829822 T -> A LOC_Os05g48560.1 upstream_gene_variant ; 1919.0bp to feature; MODIFIER silent_mutation Average:39.84; most accessible tissue: Callus, score: 91.07 N N N N
vg0527829822 T -> A LOC_Os05g48570.1 downstream_gene_variant ; 3182.0bp to feature; MODIFIER silent_mutation Average:39.84; most accessible tissue: Callus, score: 91.07 N N N N
vg0527829822 T -> A LOC_Os05g48560-LOC_Os05g48570 intergenic_region ; MODIFIER silent_mutation Average:39.84; most accessible tissue: Callus, score: 91.07 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527829822 NA 4.39E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822 NA 2.44E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822 NA 6.63E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822 6.17E-06 5.52E-07 mr1759 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822 NA 2.03E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822 NA 1.40E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822 NA 2.81E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822 NA 7.52E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251