Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527829822:

Variant ID: vg0527829822 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27829822
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GCATATGCAGATTAATCAATTATACATGCATACTAGATCAGGATCGACATGTTGGACATGGTAGTTAGCTGCATAGATTAATGGGGTGTTAATATATGAT[T/A]
ATGTGTGCTTTAGTTTCCTGTTGGATGTTGGTTTGTTTTGGTGCAACGCAATGTATCAACAAGGACACAATAGAACAAAGAGAAACGGTCATAGGCGAGG

Reverse complement sequence

CCTCGCCTATGACCGTTTCTCTTTGTTCTATTGTGTCCTTGTTGATACATTGCGTTGCACCAAAACAAACCAACATCCAACAGGAAACTAAAGCACACAT[A/T]
ATCATATATTAACACCCCATTAATCTATGCAGCTAACTACCATGTCCAACATGTCGATCCTGATCTAGTATGCATGTATAATTGATTAATCTGCATATGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	38.60%	0.15%	0.00%	NA
All Indica	2759	85.00%	14.80%	0.18%	0.00%	NA
All Japonica	1512	30.10%	69.80%	0.07%	0.00%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	89.20%	10.10%	0.67%	0.00%	NA
Indica II	465	85.40%	14.60%	0.00%	0.00%	NA
Indica III	913	89.40%	10.60%	0.00%	0.00%	NA
Indica Intermediate	786	76.60%	23.30%	0.13%	0.00%	NA
Temperate Japonica	767	2.70%	97.30%	0.00%	0.00%	NA
Tropical Japonica	504	78.60%	21.40%	0.00%	0.00%	NA
Japonica Intermediate	241	15.80%	83.80%	0.41%	0.00%	NA
VI/Aromatic	96	37.50%	61.50%	1.04%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527829822	T -> A	LOC_Os05g48560.1	upstream_gene_variant ; 1919.0bp to feature; MODIFIER	silent_mutation	Average:39.84; most accessible tissue: Callus, score: 91.07	N	N	N	N
vg0527829822	T -> A	LOC_Os05g48570.1	downstream_gene_variant ; 3182.0bp to feature; MODIFIER	silent_mutation	Average:39.84; most accessible tissue: Callus, score: 91.07	N	N	N	N
vg0527829822	T -> A	LOC_Os05g48560-LOC_Os05g48570	intergenic_region ; MODIFIER	silent_mutation	Average:39.84; most accessible tissue: Callus, score: 91.07	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527829822	NA	4.39E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822	NA	2.44E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822	NA	6.63E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822	6.17E-06	5.52E-07	mr1759	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822	NA	2.03E-23	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822	NA	1.40E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822	NA	2.81E-09	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527829822	NA	7.52E-15	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251