\
| Variant ID: vg0527800386 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 27800386 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTATAACATTTGTATTTGAAAGCATTTAAAGTATAAAACAAACATTACAAGTTTCGAAGATGTGAAGTAAAATAAATAACATCTTCAATTTATACAATG[G/A]
TAAGTAAGTTATACATCTAGTAAAAGGTATTGGGAATAGAAAATGATAATCATATTTGTATATGGATCTCTAAGAGGAATAGCCATGAAAATCGATTTTC
GAAAATCGATTTTCATGGCTATTCCTCTTAGAGATCCATATACAAATATGATTATCATTTTCTATTCCCAATACCTTTTACTAGATGTATAACTTACTTA[C/T]
CATTGTATAAATTGAAGATGTTATTTATTTTACTTCACATCTTCGAAACTTGTAATGTTTGTTTTATACTTTAAATGCTTTCAAATACAAATGTTATAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 7.60% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 96.60% | 3.00% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 5.60% | 92.90% | 1.49% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.90% | 1.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 91.60% | 7.60% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0527800386 | G -> A | LOC_Os05g48510.1 | upstream_gene_variant ; 561.0bp to feature; MODIFIER | silent_mutation | Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0527800386 | G -> A | LOC_Os05g48510.2 | upstream_gene_variant ; 561.0bp to feature; MODIFIER | silent_mutation | Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0527800386 | G -> A | LOC_Os05g48500.1 | downstream_gene_variant ; 2005.0bp to feature; MODIFIER | silent_mutation | Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0527800386 | G -> A | LOC_Os05g48500.3 | downstream_gene_variant ; 2005.0bp to feature; MODIFIER | silent_mutation | Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0527800386 | G -> A | LOC_Os05g48500.2 | downstream_gene_variant ; 2005.0bp to feature; MODIFIER | silent_mutation | Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0527800386 | G -> A | LOC_Os05g48500-LOC_Os05g48510 | intergenic_region ; MODIFIER | silent_mutation | Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0527800386 | NA | 5.68E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527800386 | NA | 3.94E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527800386 | NA | 7.94E-06 | mr1351 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527800386 | NA | 1.61E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527800386 | NA | 3.64E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527800386 | NA | 1.17E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527800386 | NA | 3.35E-06 | mr1952 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527800386 | NA | 7.80E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |