\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527800386:

Variant ID: vg0527800386 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27800386
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATAACATTTGTATTTGAAAGCATTTAAAGTATAAAACAAACATTACAAGTTTCGAAGATGTGAAGTAAAATAAATAACATCTTCAATTTATACAATG[G/A]
TAAGTAAGTTATACATCTAGTAAAAGGTATTGGGAATAGAAAATGATAATCATATTTGTATATGGATCTCTAAGAGGAATAGCCATGAAAATCGATTTTC

Reverse complement sequence

GAAAATCGATTTTCATGGCTATTCCTCTTAGAGATCCATATACAAATATGATTATCATTTTCTATTCCCAATACCTTTTACTAGATGTATAACTTACTTA[C/T]
CATTGTATAAATTGAAGATGTTATTTATTTTACTTCACATCTTCGAAACTTGTAATGTTTGTTTTATACTTTAAATGCTTTCAAATACAAATGTTATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 7.60% 0.32% 0.00% NA
All Indica  2759 96.60% 3.00% 0.40% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 5.60% 92.90% 1.49% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 97.90% 1.60% 0.44% 0.00% NA
Indica Intermediate  786 91.60% 7.60% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527800386 G -> A LOC_Os05g48510.1 upstream_gene_variant ; 561.0bp to feature; MODIFIER silent_mutation Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0527800386 G -> A LOC_Os05g48510.2 upstream_gene_variant ; 561.0bp to feature; MODIFIER silent_mutation Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0527800386 G -> A LOC_Os05g48500.1 downstream_gene_variant ; 2005.0bp to feature; MODIFIER silent_mutation Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0527800386 G -> A LOC_Os05g48500.3 downstream_gene_variant ; 2005.0bp to feature; MODIFIER silent_mutation Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0527800386 G -> A LOC_Os05g48500.2 downstream_gene_variant ; 2005.0bp to feature; MODIFIER silent_mutation Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0527800386 G -> A LOC_Os05g48500-LOC_Os05g48510 intergenic_region ; MODIFIER silent_mutation Average:38.102; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527800386 NA 5.68E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527800386 NA 3.94E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527800386 NA 7.94E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527800386 NA 1.61E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527800386 NA 3.64E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527800386 NA 1.17E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527800386 NA 3.35E-06 mr1952 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527800386 NA 7.80E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251