Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527788086:

Variant ID: vg0527788086 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27788086
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TATGGTAGTACTCGAGTTGTGAAGTTACTGATGAAAACATTCAAACTGAATTTGGTTGCTGCATTTAGGATGTCATAGGTATTTTCTTTTTTAATCTCTC[T/G]
CGCTGATTTGGTTTCATTTCATTTAGATGAGTATTGAAAACCTTTCTCTTGTGACAATTTTATTCAGTTATGTATTTCATTCAGCTGATGAATTATCCTT

Reverse complement sequence

AAGGATAATTCATCAGCTGAATGAAATACATAACTGAATAAAATTGTCACAAGAGAAAGGTTTTCAATACTCATCTAAATGAAATGAAACCAAATCAGCG[A/C]
GAGAGATTAAAAAAGAAAATACCTATGACATCCTAAATGCAGCAACCAAATTCAGTTTGAATGTTTTCATCAGTAACTTCACAACTCGAGTACTACCATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.70%	0.20%	0.06%	0.00%	NA
All Indica	2759	99.50%	0.40%	0.11%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.90%	0.90%	0.22%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527788086	T -> G	LOC_Os05g48450.1	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	N	Average:13.803; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0527788086	T -> G	LOC_Os05g48480.1	downstream_gene_variant ; 2116.0bp to feature; MODIFIER	N	Average:13.803; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0527788086	T -> G	LOC_Os05g48489.1	downstream_gene_variant ; 4285.0bp to feature; MODIFIER	N	Average:13.803; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0527788086	T -> G	LOC_Os05g48450.2	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	N	Average:13.803; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0527788086	T -> G	LOC_Os05g48450.4	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	N	Average:13.803; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0527788086	T -> G	LOC_Os05g48450.5	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	N	Average:13.803; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0527788086	T -> G	LOC_Os05g48450.6	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	N	Average:13.803; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0527788086	T -> G	LOC_Os05g48450.3	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	N	Average:13.803; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N
vg0527788086	T -> G	LOC_Os05g48470.1	intron_variant ; MODIFIER	N	Average:13.803; most accessible tissue: Minghui63 flower, score: 19.775	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527788086	5.77E-06	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	2.63E-06	9.81E-11	mr1016	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	NA	5.19E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	NA	4.77E-09	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	NA	3.01E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	NA	9.06E-06	mr1557	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	NA	1.62E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	NA	1.24E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	NA	6.78E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	NA	5.02E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	NA	1.31E-10	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527788086	5.80E-07	8.12E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251