Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527656990:

Variant ID: vg0527656990 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27656990
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCACCTTAGCCAAAAACTAAATTGTTTATTCCTATCGTCGGCTGACATAAGCCTATTGAACCTGCTCTAAGGGACAACCTTCACACAAATTTCAATAAA[G/A]
AAGAGAAAATAAGATGGCTGATTGGTGGCAAGTGTATTGGGACTAGTGTATTAAATACAATGCATCTACATAAGTTAATTTTAATTTTTGGATAGATGAT

Reverse complement sequence

ATCATCTATCCAAAAATTAAAATTAACTTATGTAGATGCATTGTATTTAATACACTAGTCCCAATACACTTGCCACCAATCAGCCATCTTATTTTCTCTT[C/T]
TTTATTGAAATTTGTGTGAAGGTTGTCCCTTAGAGCAGGTTCAATAGGCTTATGTCAGCCGACGATAGGAATAAACAATTTAGTTTTTGGCTAAGGTGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.20%	9.80%	0.00%	0.00%	NA
All Indica	2759	94.10%	5.90%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	3.30%	96.70%	0.00%	0.00%	NA
Indica I	595	96.80%	3.20%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	95.10%	4.90%	0.00%	0.00%	NA
Indica Intermediate	786	88.20%	11.80%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527656990	G -> A	LOC_Os05g48240.1	upstream_gene_variant ; 3305.0bp to feature; MODIFIER	silent_mutation	Average:96.881; most accessible tissue: Zhenshan97 root, score: 98.685	N	N	N	N
vg0527656990	G -> A	LOC_Os05g48260.1	upstream_gene_variant ; 3701.0bp to feature; MODIFIER	silent_mutation	Average:96.881; most accessible tissue: Zhenshan97 root, score: 98.685	N	N	N	N
vg0527656990	G -> A	LOC_Os05g48240.4	upstream_gene_variant ; 3305.0bp to feature; MODIFIER	silent_mutation	Average:96.881; most accessible tissue: Zhenshan97 root, score: 98.685	N	N	N	N
vg0527656990	G -> A	LOC_Os05g48250.1	downstream_gene_variant ; 687.0bp to feature; MODIFIER	silent_mutation	Average:96.881; most accessible tissue: Zhenshan97 root, score: 98.685	N	N	N	N
vg0527656990	G -> A	LOC_Os05g48240-LOC_Os05g48250	intergenic_region ; MODIFIER	silent_mutation	Average:96.881; most accessible tissue: Zhenshan97 root, score: 98.685	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0527656990	G	A	-0.02	0.03	0.03	0.02	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527656990	7.23E-07	1.39E-07	mr1245	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	8.71E-06	NA	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	8.86E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	2.97E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	7.83E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	6.68E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	4.34E-20	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	2.96E-26	mr1858	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	2.72E-26	mr1859	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	1.62E-20	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	5.93E-07	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527656990	NA	1.80E-08	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251