\
| Variant ID: vg0527579554 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 27579554 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 128. )
GGTCCGAGATATATATATCTCTCTCTAGGTATCTCAAATTAGTAGCTACTTACTAATTAGTCTTCCTAGTTAGATTATTTCTTTTCCTTTTCTTTAGTTT[C/T]
TTCTTCTTCTTCTTCCTTGTTTTTCCTTTTTTGGTTTCTTGAGAAGCTCTAAGATGAGGGGCTTCTTGGCTAGAGGCTTGGGGTTCTACCTGGTTTCAGA
TCTGAAACCAGGTAGAACCCCAAGCCTCTAGCCAAGAAGCCCCTCATCTTAGAGCTTCTCAAGAAACCAAAAAAGGAAAAACAAGGAAGAAGAAGAAGAA[G/A]
AAACTAAAGAAAAGGAAAAGAAATAATCTAACTAGGAAGACTAATTAGTAAGTAGCTACTAATTTGAGATACCTAGAGAGAGATATATATATCTCGGACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.80% | 0.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0527579554 | C -> T | LOC_Os05g48110.1 | downstream_gene_variant ; 2787.0bp to feature; MODIFIER | N | Average:50.689; most accessible tissue: Callus, score: 83.572 | N | N | N | N |
| vg0527579554 | C -> T | LOC_Os05g48110-LOC_Os05g48120 | intergenic_region ; MODIFIER | N | Average:50.689; most accessible tissue: Callus, score: 83.572 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0527579554 | NA | 1.45E-06 | mr1031 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 1.55E-06 | mr1056 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 1.40E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 1.61E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 2.62E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 8.38E-07 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 4.31E-07 | mr1817 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 1.40E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 1.46E-16 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 2.46E-09 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527579554 | NA | 1.14E-12 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |