\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527519592:

Variant ID: vg0527519592 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27519592
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTATCCGTTCTAAAATGTAAGTATTTTTAATATAGTGTCAAGTCAACCATTTTTAACTTTGACTATTAATAGCAAAACAAATAAAAAGATCAATCAT[G/A]
TAAAATTGATGTTACTAGATTTATTATTAGACAAACTATCATAATATGCAACTCTTTTTATTTAAAACATCTTATTTTTATACTTATTATTGGTCAAAGT

Reverse complement sequence

ACTTTGACCAATAATAAGTATAAAAATAAGATGTTTTAAATAAAAAGAGTTGCATATTATGATAGTTTGTCTAATAATAAATCTAGTAACATCAATTTTA[C/T]
ATGATTGATCTTTTTATTTGTTTTGCTATTAATAGTCAAAGTTAAAAATGGTTGACTTGACACTATATTAAAAATACTTACATTTTAGAACGGATAGAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 25.90% 0.13% 0.00% NA
All Indica  2759 97.10% 2.90% 0.04% 0.00% NA
All Japonica  1512 29.60% 70.20% 0.26% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 87.10% 12.70% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 2.10% 97.70% 0.26% 0.00% NA
Tropical Japonica  504 78.40% 21.20% 0.40% 0.00% NA
Japonica Intermediate  241 14.90% 85.10% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 61.50% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527519592 G -> A LOC_Os05g48000.1 upstream_gene_variant ; 1434.0bp to feature; MODIFIER silent_mutation Average:43.486; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0527519592 G -> A LOC_Os05g47980-LOC_Os05g48000 intergenic_region ; MODIFIER silent_mutation Average:43.486; most accessible tissue: Minghui63 root, score: 77.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527519592 NA 3.63E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 4.45E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 2.07E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 2.16E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 1.89E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 9.98E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 3.42E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 8.23E-07 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 7.87E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 2.37E-15 mr1301_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 1.23E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 6.68E-06 NA mr1410_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 8.14E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 7.85E-06 2.35E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 1.17E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 1.96E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 3.05E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527519592 NA 2.74E-09 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251