\
| Variant ID: vg0527488306 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 27488306 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 113. )
TGTACTGGATCGGAGCATTGTTTTTCAATAAACAACAGTTTTCCTTTGCGAGAATCATGCGCATTTAATCTATCATATTGTTTGTAGGCTACTCTCTCTC[C/T]
ATTTTAAAATAAAATGTAAAATATTTAAGGTTTATCTCCACGTTGAACGTTTTCAAGTTTGAATAAATTTATAGAAAAAACCGCAACACAATTTTCAACA
TGTTGAAAATTGTGTTGCGGTTTTTTCTATAAATTTATTCAAACTTGAAAACGTTCAACGTGGAGATAAACCTTAAATATTTTACATTTTATTTTAAAAT[G/A]
GAGAGAGAGTAGCCTACAAACAATATGATAGATTAAATGCGCATGATTCTCGCAAAGGAAAACTGTTGTTTATTGAAAAACAATGCTCCGATCCAGTACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.90% | 29.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 96.30% | 3.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 28.80% | 71.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 59.10% | 40.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.40% | 23.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.90% | 86.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 35.40% | 64.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0527488306 | C -> T | LOC_Os05g47950.1 | upstream_gene_variant ; 713.0bp to feature; MODIFIER | silent_mutation | Average:46.608; most accessible tissue: Callus, score: 87.64 | N | N | N | N |
| vg0527488306 | C -> T | LOC_Os05g47940.1 | downstream_gene_variant ; 4393.0bp to feature; MODIFIER | silent_mutation | Average:46.608; most accessible tissue: Callus, score: 87.64 | N | N | N | N |
| vg0527488306 | C -> T | LOC_Os05g47950-LOC_Os05g47960 | intergenic_region ; MODIFIER | silent_mutation | Average:46.608; most accessible tissue: Callus, score: 87.64 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0527488306 | NA | 4.34E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 4.71E-54 | mr1241 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 3.53E-12 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 6.72E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 2.36E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 1.75E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 4.84E-07 | mr1817 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 1.01E-12 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 1.03E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 1.28E-64 | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 2.47E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 1.23E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 5.29E-10 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 4.51E-11 | mr1471_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 1.93E-09 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 8.36E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 5.13E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 1.33E-10 | mr1817_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 2.24E-14 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527488306 | NA | 8.82E-12 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |