Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527299171:

Variant ID: vg0527299171 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27299171
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATGCAAGGAATTCTGGGAACCGGTTTCTTTTCAGCTAAGTGTATACACTACTAGACTACGAATCCGAGGCTAAAGATGTCAATACATGTGTTCACTTC[A/G]
TTTGTTGGTGAGTCTCAGATACTAATAGTCAAATAGTTTTTAAAAAAATTAACAACATTGGTCATCTATCATCGTGCAAAAAATCAATTTCAAATTTGAT

Reverse complement sequence

ATCAAATTTGAAATTGATTTTTTGCACGATGATAGATGACCAATGTTGTTAATTTTTTTAAAAACTATTTGACTATTAGTATCTGAGACTCACCAACAAA[T/C]
GAAGTGAACACATGTATTGACATCTTTAGCCTCGGATTCGTAGTCTAGTAGTGTATACACTTAGCTGAAAAGAAACCGGTTCCCAGAATTCCTTGCATGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.50%	10.80%	0.49%	23.19%	NA
All Indica	2759	62.70%	0.10%	0.40%	36.72%	NA
All Japonica	1512	66.90%	32.50%	0.53%	0.07%	NA
Aus	269	84.40%	0.00%	0.00%	15.61%	NA
Indica I	595	69.10%	0.00%	0.34%	30.59%	NA
Indica II	465	70.80%	0.90%	0.22%	28.17%	NA
Indica III	913	57.10%	0.00%	0.22%	42.72%	NA
Indica Intermediate	786	59.80%	0.00%	0.76%	39.44%	NA
Temperate Japonica	767	43.50%	55.80%	0.65%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.00%	0.20%	NA
Japonica Intermediate	241	73.40%	25.30%	1.24%	0.00%	NA
VI/Aromatic	96	75.00%	0.00%	1.04%	23.96%	NA
Intermediate	90	62.20%	15.60%	3.33%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527299171	A -> DEL	N	N	silent_mutation	Average:57.321; most accessible tissue: Zhenshan97 root, score: 78.04	N	N	N	N
vg0527299171	A -> G	LOC_Os05g47650.1	upstream_gene_variant ; 3814.0bp to feature; MODIFIER	silent_mutation	Average:57.321; most accessible tissue: Zhenshan97 root, score: 78.04	N	N	N	N
vg0527299171	A -> G	LOC_Os05g47640-LOC_Os05g47650	intergenic_region ; MODIFIER	silent_mutation	Average:57.321; most accessible tissue: Zhenshan97 root, score: 78.04	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527299171	NA	9.05E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0527299171	NA	5.40E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	2.19E-12	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	9.26E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	1.30E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	2.92E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	1.94E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	1.05E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	1.59E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	7.15E-06	6.11E-10	mr1880	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	3.56E-11	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	1.05E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	7.17E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	1.96E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	1.56E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	6.23E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	2.32E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527299171	NA	3.49E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251