\
| Variant ID: vg0527299171 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 27299171 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCATGCAAGGAATTCTGGGAACCGGTTTCTTTTCAGCTAAGTGTATACACTACTAGACTACGAATCCGAGGCTAAAGATGTCAATACATGTGTTCACTTC[A/G]
TTTGTTGGTGAGTCTCAGATACTAATAGTCAAATAGTTTTTAAAAAAATTAACAACATTGGTCATCTATCATCGTGCAAAAAATCAATTTCAAATTTGAT
ATCAAATTTGAAATTGATTTTTTGCACGATGATAGATGACCAATGTTGTTAATTTTTTTAAAAACTATTTGACTATTAGTATCTGAGACTCACCAACAAA[T/C]
GAAGTGAACACATGTATTGACATCTTTAGCCTCGGATTCGTAGTCTAGTAGTGTATACACTTAGCTGAAAAGAAACCGGTTCCCAGAATTCCTTGCATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 10.80% | 0.49% | 23.19% | NA |
| All Indica | 2759 | 62.70% | 0.10% | 0.40% | 36.72% | NA |
| All Japonica | 1512 | 66.90% | 32.50% | 0.53% | 0.07% | NA |
| Aus | 269 | 84.40% | 0.00% | 0.00% | 15.61% | NA |
| Indica I | 595 | 69.10% | 0.00% | 0.34% | 30.59% | NA |
| Indica II | 465 | 70.80% | 0.90% | 0.22% | 28.17% | NA |
| Indica III | 913 | 57.10% | 0.00% | 0.22% | 42.72% | NA |
| Indica Intermediate | 786 | 59.80% | 0.00% | 0.76% | 39.44% | NA |
| Temperate Japonica | 767 | 43.50% | 55.80% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 73.40% | 25.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 75.00% | 0.00% | 1.04% | 23.96% | NA |
| Intermediate | 90 | 62.20% | 15.60% | 3.33% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0527299171 | A -> DEL | N | N | silent_mutation | Average:57.321; most accessible tissue: Zhenshan97 root, score: 78.04 | N | N | N | N |
| vg0527299171 | A -> G | LOC_Os05g47650.1 | upstream_gene_variant ; 3814.0bp to feature; MODIFIER | silent_mutation | Average:57.321; most accessible tissue: Zhenshan97 root, score: 78.04 | N | N | N | N |
| vg0527299171 | A -> G | LOC_Os05g47640-LOC_Os05g47650 | intergenic_region ; MODIFIER | silent_mutation | Average:57.321; most accessible tissue: Zhenshan97 root, score: 78.04 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0527299171 | NA | 9.05E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0527299171 | NA | 5.40E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 2.19E-12 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 9.26E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 1.30E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 2.92E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 1.94E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 1.05E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 1.59E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | 7.15E-06 | 6.11E-10 | mr1880 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 3.56E-11 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 1.05E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 7.17E-08 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 1.96E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 1.56E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 6.23E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 2.32E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527299171 | NA | 3.49E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |