\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527284387:

Variant ID: vg0527284387 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27284387
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCGGGGCGTGACATAGTAGGAATGTGGTACTAATTCCCATTGTTAGCTTGGACCGACGACCATGTGTGCGGATATGGTACTAAGAGCAGGTACAATAG[C/A]
AGGCTATAAGCCAGCTGTAAACATATTTTAAAGAGATAAATAAGAAGAGAGATGGGCAGCGGGCTACAGATTTATAGCCAGCTGCAGCACGGACTCCAAG

Reverse complement sequence

CTTGGAGTCCGTGCTGCAGCTGGCTATAAATCTGTAGCCCGCTGCCCATCTCTCTTCTTATTTATCTCTTTAAAATATGTTTACAGCTGGCTTATAGCCT[G/T]
CTATTGTACCTGCTCTTAGTACCATATCCGCACACATGGTCGTCGGTCCAAGCTAACAATGGGAATTAGTACCACATTCCTACTATGTCACGCCCCGAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 27.30% 0.51% 0.00% NA
All Indica  2759 64.00% 35.30% 0.72% 0.00% NA
All Japonica  1512 80.90% 18.80% 0.26% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 36.10% 62.90% 1.01% 0.00% NA
Indica II  465 88.60% 11.40% 0.00% 0.00% NA
Indica III  913 66.80% 32.30% 0.88% 0.00% NA
Indica Intermediate  786 67.20% 32.10% 0.76% 0.00% NA
Temperate Japonica  767 98.30% 1.60% 0.13% 0.00% NA
Tropical Japonica  504 49.00% 50.40% 0.60% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527284387 C -> A LOC_Os05g47610.1 upstream_gene_variant ; 1178.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0527284387 C -> A LOC_Os05g47620.1 upstream_gene_variant ; 1041.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0527284387 C -> A LOC_Os05g47630.1 upstream_gene_variant ; 2650.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0527284387 C -> A LOC_Os05g47610-LOC_Os05g47620 intergenic_region ; MODIFIER silent_mutation Average:42.933; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527284387 NA 1.65E-10 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0527284387 NA 7.31E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 3.14E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 9.32E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 1.07E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 4.31E-07 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 3.16E-06 NA mr1030_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 7.04E-06 mr1030_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 6.91E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 3.33E-06 3.33E-06 mr1273_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 6.41E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 6.55E-06 mr1348_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 4.29E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 5.08E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 9.80E-07 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 6.81E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 1.06E-06 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 1.84E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 1.25E-17 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 2.55E-09 mr1754_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 7.51E-07 mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 2.02E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527284387 NA 7.24E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251