Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527271146:

Variant ID: vg0527271146 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27271146
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGGAGTTCTTCCAGGAGCAAGCCGGCTACGATGAGTTTTAGGGTTTCGGCCTAGTTCCCAAGTCGCGCCTGTGATTGTTTGGTCCAAGTCCTGGCTTC[T/C]
GTTTTCCTTTTGTAATGCAGTTGTGAGCTCGGGATCTGTCCGCAGCCCAACATGACTGTACTTCTACTCTATAATAAAGAGACCTCTGTTGCTGTGATAC

Reverse complement sequence

GTATCACAGCAACAGAGGTCTCTTTATTATAGAGTAGAAGTACAGTCATGTTGGGCTGCGGACAGATCCCGAGCTCACAACTGCATTACAAAAGGAAAAC[A/G]
GAAGCCAGGACTTGGACCAAACAATCACAGGCGCGACTTGGGAACTAGGCCGAAACCCTAAAACTCATCGTAGCCGGCTTGCTCCTGGAAGAACTCCTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.80%	10.90%	29.69%	28.63%	NA
All Indica	2759	32.50%	2.30%	38.31%	26.89%	NA
All Japonica	1512	34.10%	26.70%	7.21%	32.01%	NA
Aus	269	3.30%	1.50%	68.03%	27.14%	NA
Indica I	595	23.40%	2.40%	21.85%	52.44%	NA
Indica II	465	37.40%	1.90%	32.90%	27.74%	NA
Indica III	913	34.20%	2.10%	52.46%	11.28%	NA
Indica Intermediate	786	34.50%	2.80%	37.53%	25.19%	NA
Temperate Japonica	767	55.00%	38.50%	4.69%	1.83%	NA
Tropical Japonica	504	6.50%	4.60%	10.71%	78.17%	NA
Japonica Intermediate	241	25.30%	35.30%	7.88%	31.54%	NA
VI/Aromatic	96	6.20%	40.60%	25.00%	28.12%	NA
Intermediate	90	31.10%	5.60%	33.33%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527271146	T -> DEL	N	N	silent_mutation	Average:6.737; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0527271146	T -> C	LOC_Os05g47600.1	upstream_gene_variant ; 384.0bp to feature; MODIFIER	silent_mutation	Average:6.737; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0527271146	T -> C	LOC_Os05g47610.1	downstream_gene_variant ; 4795.0bp to feature; MODIFIER	silent_mutation	Average:6.737; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0527271146	T -> C	LOC_Os05g47590-LOC_Os05g47600	intergenic_region ; MODIFIER	silent_mutation	Average:6.737; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527271146	4.72E-06	NA	mr1014	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527271146	NA	1.01E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527271146	NA	2.37E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251