Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0527265673:

Variant ID: vg0527265673 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27265673
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CCAACATATGAATGACCGCGCACAGGCGCGGTGGATGAACCCCGTCGTGCCGAACTGCGACAATTGCGGCCATGAGAAATGCATGCGTCCAGTGATAGCC[G/A]
CCGAGAAGGAGCGTATCAACTGGTTGTTCCTACTGCTTGGGGAGACACTAGGTTTGCGCATGCTTGATCAGCTCAAGTATTTTTGCGCGCACACCAATCG

Reverse complement sequence

CGATTGGTGTGCGCGCAAAAATACTTGAGCTGATCAAGCATGCGCAAACCTAGTGTCTCCCCAAGCAGTAGGAACAACCAGTTGATACGCTCCTTCTCGG[C/T]
GGCTATCACTGGACGCATGCATTTCTCATGGCCGCAATTGTCGCAGTTCGGCACGACGGGGTTCATCCACCGCGCCTGTGCGCGGTCATTCATATGTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 24.60% 0.13% 0.25% NA
All Indica  2759 98.90% 1.00% 0.04% 0.07% NA
All Japonica  1512 39.30% 60.10% 0.00% 0.60% NA
Aus  269 34.90% 63.60% 1.49% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 1.90% 0.00% 0.22% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.70% 0.13% 0.13% NA
Temperate Japonica  767 3.00% 96.60% 0.00% 0.39% NA
Tropical Japonica  504 94.80% 4.80% 0.00% 0.40% NA
Japonica Intermediate  241 38.60% 59.80% 0.00% 1.66% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527265673 G -> DEL LOC_Os05g47590.1 N frameshift_variant Average:59.934; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0527265673 G -> A LOC_Os05g47590.1 missense_variant ; p.Ala362Thr; MODERATE nonsynonymous_codon ; A362T Average:59.934; most accessible tissue: Zhenshan97 young leaf, score: 71.923 benign 0.383 TOLERATED 0.41

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527265673 NA 2.53E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 4.53E-16 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 3.59E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 2.27E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 3.06E-26 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.38E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 6.17E-14 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 6.03E-28 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.01E-13 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 6.85E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 2.06E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.90E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.98E-28 mr1920 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 4.87E-12 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 7.76E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 9.64E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.89E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 7.46E-10 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 4.41E-12 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.46E-12 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 3.92E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 8.95E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 7.85E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 7.20E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 2.76E-10 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 9.36E-07 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 7.98E-26 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 7.81E-10 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 7.88E-13 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 4.29E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.58E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 4.65E-11 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.43E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.84E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 5.58E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 3.91E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 2.99E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 3.77E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 2.68E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265673 NA 1.03E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251