Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527265168:

Variant ID: vg0527265168 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27265168
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCTTCTCGCGCTCCGACAGTGATGACGTCCACCGAGGAGCGGCCGGCGACGGCTGCCTGTGTGGCCTCCCGATCTTTGATCCCCAACGGTGCAGTCCC[G/A]
GTATTCCCATGCTTCAATTTCCTTGGAACTTCAACGTCATCATCAAGCCTATCACACCTCCATCAACAATCTTCCTCGACTCTACGTCAAAGCAATGTGT

Reverse complement sequence

ACACATTGCTTTGACGTAGAGTCGAGGAAGATTGTTGATGGAGGTGTGATAGGCTTGATGATGACGTTGAAGTTCCAAGGAAATTGAAGCATGGGAATAC[C/T]
GGGACTGCACCGTTGGGGATCAAAGATCGGGAGGCCACACAGGCAGCCGTCGCCGGCCGCTCCTCGGTGGACGTCATCACTGTCGGAGCGCGAGAAGAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	6.20%	0.70%	0.00%	NA
All Indica	2759	94.90%	4.10%	1.05%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	34.20%	65.10%	0.74%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	81.50%	14.00%	4.52%	0.00%	NA
Indica III	913	97.90%	2.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	3.60%	0.64%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527265168	G -> A	LOC_Os05g47590.1	synonymous_variant ; p.Pro193Pro; LOW	synonymous_codon	Average:61.419; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0527265168	G -> A	LOC_Os05g47590.1	synonymous_variant ; p.Pro193Pro; LOW	nonsynonymous_codon ; P193A	Average:61.419; most accessible tissue: Zhenshan97 panicle, score: 78.302	unknown	unknown	DELETERIOUS	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527265168	NA	4.64E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	9.37E-15	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	2.83E-17	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	1.20E-11	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	7.20E-08	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	1.11E-10	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	8.92E-07	mr1049_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	1.62E-07	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	2.48E-11	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	5.14E-09	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	2.96E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	1.81E-06	NA	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	2.42E-07	5.79E-16	mr1498_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	3.41E-06	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	1.13E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	3.26E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	2.26E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	1.74E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	NA	1.57E-15	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	5.94E-06	4.85E-09	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527265168	2.36E-06	5.78E-14	mr1951_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251