\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527263305:

Variant ID: vg0527263305 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27263305
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGGAATGCCTCATTCTCGGCGCGCGGCACCTCCTCGATGCGCGGGGACGACGCCCGCCTCAACGATCGAACACACGCCGTGGTGACGAGGAGTCCAC[A/G]
GCTGCCACCGTTCCACGCTAGTGCCGTGTCCACAACCGCTGCCACTTTCTACATCTGCCGTATTCCATCCGTCCATAAAAGTTAAGACATATTTCACATT

Reverse complement sequence

AATGTGAAATATGTCTTAACTTTTATGGACGGATGGAATACGGCAGATGTAGAAAGTGGCAGCGGTTGTGGACACGGCACTAGCGTGGAACGGTGGCAGC[T/C]
GTGGACTCCTCGTCACCACGGCGTGTGTTCGATCGTTGAGGCGGGCGTCGTCCCCGCGCATCGAGGAGGTGCCGCGCGCCGAGAATGAGGCATTCCTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 30.50% 1.63% 0.00% NA
All Indica  2759 63.10% 34.30% 2.57% 0.00% NA
All Japonica  1512 80.90% 19.00% 0.13% 0.00% NA
Aus  269 31.20% 68.00% 0.74% 0.00% NA
Indica I  595 35.60% 57.10% 7.23% 0.00% NA
Indica II  465 86.90% 11.00% 2.15% 0.00% NA
Indica III  913 67.00% 32.90% 0.11% 0.00% NA
Indica Intermediate  786 65.30% 32.60% 2.16% 0.00% NA
Temperate Japonica  767 98.00% 1.70% 0.26% 0.00% NA
Tropical Japonica  504 49.40% 50.60% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527263305 A -> G LOC_Os05g47590.1 upstream_gene_variant ; 1164.0bp to feature; MODIFIER silent_mutation Average:72.25; most accessible tissue: Callus, score: 97.103 N N N N
vg0527263305 A -> G LOC_Os05g47580.1 downstream_gene_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:72.25; most accessible tissue: Callus, score: 97.103 N N N N
vg0527263305 A -> G LOC_Os05g47580-LOC_Os05g47590 intergenic_region ; MODIFIER silent_mutation Average:72.25; most accessible tissue: Callus, score: 97.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527263305 NA 7.40E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 5.91E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 6.63E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 1.22E-07 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 8.44E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 3.05E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 6.41E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 7.59E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 4.73E-06 4.72E-06 mr1273_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 6.33E-07 6.33E-07 mr1273_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 7.09E-08 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 8.95E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 3.68E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 1.43E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 2.54E-07 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 9.79E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 3.33E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 1.14E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 3.15E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 5.25E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 1.25E-06 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 4.22E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 2.51E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 5.50E-08 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 4.26E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 2.79E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527263305 NA 8.88E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251