\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527183886:

Variant ID: vg0527183886 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27183886
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCCTCACCCGTGGATTTAACGCAACTCATCTGGGCCTCTCTCCTTTCGGCCCAAGGCCCATCTTGGCCGTCCGATCCGAGACCTTCCTTCCTGGGTCG[T/C]
CCGATCGGAATCGCTTTCCGCGAGAGGATATATTCGCGGAAAAGTCTCGCTCTCTTCTCGCTCTTCCCAACCCTTTCCATTTTTTCCACCCACACAACGG

Reverse complement sequence

CCGTTGTGTGGGTGGAAAAAATGGAAAGGGTTGGGAAGAGCGAGAAGAGAGCGAGACTTTTCCGCGAATATATCCTCTCGCGGAAAGCGATTCCGATCGG[A/G]
CGACCCAGGAAGGAAGGTCTCGGATCGGACGGCCAAGATGGGCCTTGGGCCGAAAGGAGAGAGGCCCAGATGAGTTGCGTTAAATCCACGGGTGAGGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 36.10% 0.47% 0.00% NA
All Indica  2759 90.40% 9.00% 0.65% 0.00% NA
All Japonica  1512 22.90% 77.00% 0.07% 0.00% NA
Aus  269 21.20% 78.40% 0.37% 0.00% NA
Indica I  595 96.00% 2.70% 1.34% 0.00% NA
Indica II  465 66.70% 32.30% 1.08% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 89.80% 9.50% 0.64% 0.00% NA
Temperate Japonica  767 4.30% 95.60% 0.13% 0.00% NA
Tropical Japonica  504 53.00% 47.00% 0.00% 0.00% NA
Japonica Intermediate  241 19.50% 80.50% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 43.80% 1.04% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527183886 T -> C LOC_Os05g47446.1 upstream_gene_variant ; 108.0bp to feature; MODIFIER silent_mutation Average:94.857; most accessible tissue: Callus, score: 99.018 N N N N
vg0527183886 T -> C LOC_Os05g47450.1 upstream_gene_variant ; 2473.0bp to feature; MODIFIER silent_mutation Average:94.857; most accessible tissue: Callus, score: 99.018 N N N N
vg0527183886 T -> C LOC_Os05g47446.2 upstream_gene_variant ; 108.0bp to feature; MODIFIER silent_mutation Average:94.857; most accessible tissue: Callus, score: 99.018 N N N N
vg0527183886 T -> C LOC_Os05g47446-LOC_Os05g47450 intergenic_region ; MODIFIER silent_mutation Average:94.857; most accessible tissue: Callus, score: 99.018 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0527183886 T C -0.03 -0.06 -0.04 -0.04 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527183886 NA 3.74E-09 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 4.25E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 2.18E-06 mr1044 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 2.31E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 1.34E-09 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 5.95E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 6.84E-07 1.09E-13 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 7.11E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 3.65E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 2.19E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 2.30E-08 mr1482 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 3.81E-07 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 2.88E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 3.82E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 3.66E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 1.33E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 2.70E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 9.15E-23 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 1.14E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 7.66E-13 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 5.45E-11 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 8.64E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 1.79E-10 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 6.16E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 1.12E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527183886 NA 6.41E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251