Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527177720:

Variant ID: vg0527177720 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27177720
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCATCGCGTATTTAAACTTGTATTTCTGTTGACTTGTACCGGAGCAGTTTGCATGTTATGTTTTTTTCACTTGAGCTAAACTGCAGCTATTAATCAGTT[C/A]
TGTTTAAGTGAAAAATATCCATGTAGTGTGCCTGGATTTGAAGATGTTTGTTAGTTTGAAATATGCATGTACCACACGATTATACTACTTGAAGTTGTGT

Reverse complement sequence

ACACAACTTCAAGTAGTATAATCGTGTGGTACATGCATATTTCAAACTAACAAACATCTTCAAATCCAGGCACACTACATGGATATTTTTCACTTAAACA[G/T]
AACTGATTAATAGCTGCAGTTTAGCTCAAGTGAAAAAAACATAACATGCAAACTGCTCCGGTACAAGTCAACAGAAATACAAGTTTAAATACGCGATGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.10%	3.20%	1.10%	48.54%	NA
All Indica	2759	20.80%	0.40%	1.41%	77.31%	NA
All Japonica	1512	84.90%	8.70%	0.20%	6.15%	NA
Aus	269	82.90%	0.00%	2.23%	14.87%	NA
Indica I	595	8.70%	0.20%	1.01%	90.08%	NA
Indica II	465	18.30%	0.20%	1.51%	80.00%	NA
Indica III	913	31.80%	0.40%	0.99%	66.81%	NA
Indica Intermediate	786	18.80%	0.80%	2.16%	78.24%	NA
Temperate Japonica	767	96.70%	0.10%	0.13%	3.00%	NA
Tropical Japonica	504	66.70%	24.00%	0.40%	8.93%	NA
Japonica Intermediate	241	85.50%	4.10%	0.00%	10.37%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	60.00%	5.60%	4.44%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527177720	C -> DEL	N	N	silent_mutation	Average:13.453; most accessible tissue: Callus, score: 91.72	N	N	N	N
vg0527177720	C -> A	LOC_Os05g47442.1	downstream_gene_variant ; 174.0bp to feature; MODIFIER	silent_mutation	Average:13.453; most accessible tissue: Callus, score: 91.72	N	N	N	N
vg0527177720	C -> A	LOC_Os05g47446.1	downstream_gene_variant ; 1499.0bp to feature; MODIFIER	silent_mutation	Average:13.453; most accessible tissue: Callus, score: 91.72	N	N	N	N
vg0527177720	C -> A	LOC_Os05g47446.2	downstream_gene_variant ; 1499.0bp to feature; MODIFIER	silent_mutation	Average:13.453; most accessible tissue: Callus, score: 91.72	N	N	N	N
vg0527177720	C -> A	LOC_Os05g46954-LOC_Os05g47442	intergenic_region ; MODIFIER	silent_mutation	Average:13.453; most accessible tissue: Callus, score: 91.72	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527177720	NA	2.83E-06	mr1215	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177720	NA	4.45E-07	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177720	NA	1.06E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177720	1.75E-06	6.44E-11	mr1583	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177720	4.58E-06	2.03E-07	mr1835	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177720	NA	1.78E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177720	7.54E-06	5.43E-07	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251