\
| Variant ID: vg0527177036 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 27177036 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCAGCTATCACCCCATGTATGTACAGTTCGCGAAAAGAAAATTTTTAGGTATCACATCGGACGTTTGACCGAATATCGGAAGGGGTTTTCGGACACGAAT[G/A]
AAAAAAACTAATTTCATAACTCGCATGGAAACCGCGAGATGAATCTCTTGAGCCTAATTAATTCGTCATTAGCATATGTGGGTTACTGTAGCAATTAGTT
AACTAATTGCTACAGTAACCCACATATGCTAATGACGAATTAATTAGGCTCAAGAGATTCATCTCGCGGTTTCCATGCGAGTTATGAAATTAGTTTTTTT[C/T]
ATTCGTGTCCGAAAACCCCTTCCGATATTCGGTCAAACGTCCGATGTGATACCTAAAAATTTTCTTTTCGCGAACTGTACATACATGGGGTGATAGCTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.70% | 5.00% | 0.34% | 72.96% | NA |
| All Indica | 2759 | 3.00% | 0.80% | 0.47% | 95.72% | NA |
| All Japonica | 1512 | 58.10% | 0.00% | 0.20% | 41.67% | NA |
| Aus | 269 | 0.00% | 78.40% | 0.00% | 21.56% | NA |
| Indica I | 595 | 5.50% | 0.20% | 0.34% | 93.95% | NA |
| Indica II | 465 | 4.10% | 0.40% | 0.86% | 94.62% | NA |
| Indica III | 913 | 0.40% | 0.10% | 0.22% | 99.23% | NA |
| Indica Intermediate | 786 | 3.60% | 2.20% | 0.64% | 93.64% | NA |
| Temperate Japonica | 767 | 95.00% | 0.00% | 0.13% | 4.82% | NA |
| Tropical Japonica | 504 | 5.20% | 0.00% | 0.40% | 94.44% | NA |
| Japonica Intermediate | 241 | 51.50% | 0.00% | 0.00% | 48.55% | NA |
| VI/Aromatic | 96 | 36.50% | 2.10% | 0.00% | 61.46% | NA |
| Intermediate | 90 | 30.00% | 3.30% | 0.00% | 66.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0527177036 | G -> DEL | N | N | silent_mutation | Average:14.333; most accessible tissue: Callus, score: 98.453 | N | N | N | N |
| vg0527177036 | G -> A | LOC_Os05g47442.1 | downstream_gene_variant ; 858.0bp to feature; MODIFIER | silent_mutation | Average:14.333; most accessible tissue: Callus, score: 98.453 | N | N | N | N |
| vg0527177036 | G -> A | LOC_Os05g47446.1 | downstream_gene_variant ; 2183.0bp to feature; MODIFIER | silent_mutation | Average:14.333; most accessible tissue: Callus, score: 98.453 | N | N | N | N |
| vg0527177036 | G -> A | LOC_Os05g47446.2 | downstream_gene_variant ; 2183.0bp to feature; MODIFIER | silent_mutation | Average:14.333; most accessible tissue: Callus, score: 98.453 | N | N | N | N |
| vg0527177036 | G -> A | LOC_Os05g46954-LOC_Os05g47442 | intergenic_region ; MODIFIER | silent_mutation | Average:14.333; most accessible tissue: Callus, score: 98.453 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0527177036 | NA | 4.04E-14 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 2.21E-21 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 8.93E-13 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 4.45E-24 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | 2.45E-06 | 7.71E-07 | mr1392 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 2.09E-22 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 6.90E-07 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 2.78E-26 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 4.61E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 4.65E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 8.60E-08 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 5.72E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 4.05E-20 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 4.59E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 9.78E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 7.15E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 3.01E-15 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 7.65E-12 | mr1918_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527177036 | NA | 4.81E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |