\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527177036:

Variant ID: vg0527177036 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27177036
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGCTATCACCCCATGTATGTACAGTTCGCGAAAAGAAAATTTTTAGGTATCACATCGGACGTTTGACCGAATATCGGAAGGGGTTTTCGGACACGAAT[G/A]
AAAAAAACTAATTTCATAACTCGCATGGAAACCGCGAGATGAATCTCTTGAGCCTAATTAATTCGTCATTAGCATATGTGGGTTACTGTAGCAATTAGTT

Reverse complement sequence

AACTAATTGCTACAGTAACCCACATATGCTAATGACGAATTAATTAGGCTCAAGAGATTCATCTCGCGGTTTCCATGCGAGTTATGAAATTAGTTTTTTT[C/T]
ATTCGTGTCCGAAAACCCCTTCCGATATTCGGTCAAACGTCCGATGTGATACCTAAAAATTTTCTTTTCGCGAACTGTACATACATGGGGTGATAGCTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.70% 5.00% 0.34% 72.96% NA
All Indica  2759 3.00% 0.80% 0.47% 95.72% NA
All Japonica  1512 58.10% 0.00% 0.20% 41.67% NA
Aus  269 0.00% 78.40% 0.00% 21.56% NA
Indica I  595 5.50% 0.20% 0.34% 93.95% NA
Indica II  465 4.10% 0.40% 0.86% 94.62% NA
Indica III  913 0.40% 0.10% 0.22% 99.23% NA
Indica Intermediate  786 3.60% 2.20% 0.64% 93.64% NA
Temperate Japonica  767 95.00% 0.00% 0.13% 4.82% NA
Tropical Japonica  504 5.20% 0.00% 0.40% 94.44% NA
Japonica Intermediate  241 51.50% 0.00% 0.00% 48.55% NA
VI/Aromatic  96 36.50% 2.10% 0.00% 61.46% NA
Intermediate  90 30.00% 3.30% 0.00% 66.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527177036 G -> DEL N N silent_mutation Average:14.333; most accessible tissue: Callus, score: 98.453 N N N N
vg0527177036 G -> A LOC_Os05g47442.1 downstream_gene_variant ; 858.0bp to feature; MODIFIER silent_mutation Average:14.333; most accessible tissue: Callus, score: 98.453 N N N N
vg0527177036 G -> A LOC_Os05g47446.1 downstream_gene_variant ; 2183.0bp to feature; MODIFIER silent_mutation Average:14.333; most accessible tissue: Callus, score: 98.453 N N N N
vg0527177036 G -> A LOC_Os05g47446.2 downstream_gene_variant ; 2183.0bp to feature; MODIFIER silent_mutation Average:14.333; most accessible tissue: Callus, score: 98.453 N N N N
vg0527177036 G -> A LOC_Os05g46954-LOC_Os05g47442 intergenic_region ; MODIFIER silent_mutation Average:14.333; most accessible tissue: Callus, score: 98.453 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527177036 NA 4.04E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 2.21E-21 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 8.93E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 4.45E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 2.45E-06 7.71E-07 mr1392 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 2.09E-22 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 6.90E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 2.78E-26 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 4.61E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 4.65E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 8.60E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 5.72E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 4.05E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 4.59E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 9.78E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 7.15E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 3.01E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 7.65E-12 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036 NA 4.81E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251