Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527177036:

Variant ID: vg0527177036 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27177036
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAGCTATCACCCCATGTATGTACAGTTCGCGAAAAGAAAATTTTTAGGTATCACATCGGACGTTTGACCGAATATCGGAAGGGGTTTTCGGACACGAAT[G/A]
AAAAAAACTAATTTCATAACTCGCATGGAAACCGCGAGATGAATCTCTTGAGCCTAATTAATTCGTCATTAGCATATGTGGGTTACTGTAGCAATTAGTT

Reverse complement sequence

AACTAATTGCTACAGTAACCCACATATGCTAATGACGAATTAATTAGGCTCAAGAGATTCATCTCGCGGTTTCCATGCGAGTTATGAAATTAGTTTTTTT[C/T]
ATTCGTGTCCGAAAACCCCTTCCGATATTCGGTCAAACGTCCGATGTGATACCTAAAAATTTTCTTTTCGCGAACTGTACATACATGGGGTGATAGCTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.70%	5.00%	0.34%	72.96%	NA
All Indica	2759	3.00%	0.80%	0.47%	95.72%	NA
All Japonica	1512	58.10%	0.00%	0.20%	41.67%	NA
Aus	269	0.00%	78.40%	0.00%	21.56%	NA
Indica I	595	5.50%	0.20%	0.34%	93.95%	NA
Indica II	465	4.10%	0.40%	0.86%	94.62%	NA
Indica III	913	0.40%	0.10%	0.22%	99.23%	NA
Indica Intermediate	786	3.60%	2.20%	0.64%	93.64%	NA
Temperate Japonica	767	95.00%	0.00%	0.13%	4.82%	NA
Tropical Japonica	504	5.20%	0.00%	0.40%	94.44%	NA
Japonica Intermediate	241	51.50%	0.00%	0.00%	48.55%	NA
VI/Aromatic	96	36.50%	2.10%	0.00%	61.46%	NA
Intermediate	90	30.00%	3.30%	0.00%	66.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527177036	G -> DEL	N	N	silent_mutation	Average:14.333; most accessible tissue: Callus, score: 98.453	N	N	N	N
vg0527177036	G -> A	LOC_Os05g47442.1	downstream_gene_variant ; 858.0bp to feature; MODIFIER	silent_mutation	Average:14.333; most accessible tissue: Callus, score: 98.453	N	N	N	N
vg0527177036	G -> A	LOC_Os05g47446.1	downstream_gene_variant ; 2183.0bp to feature; MODIFIER	silent_mutation	Average:14.333; most accessible tissue: Callus, score: 98.453	N	N	N	N
vg0527177036	G -> A	LOC_Os05g47446.2	downstream_gene_variant ; 2183.0bp to feature; MODIFIER	silent_mutation	Average:14.333; most accessible tissue: Callus, score: 98.453	N	N	N	N
vg0527177036	G -> A	LOC_Os05g46954-LOC_Os05g47442	intergenic_region ; MODIFIER	silent_mutation	Average:14.333; most accessible tissue: Callus, score: 98.453	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527177036	NA	4.04E-14	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	2.21E-21	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	8.93E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	4.45E-24	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	2.45E-06	7.71E-07	mr1392	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	2.09E-22	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	6.90E-07	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	2.78E-26	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	4.61E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	4.65E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	8.60E-08	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	5.72E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	4.05E-20	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	4.59E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	9.78E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	7.15E-12	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	3.01E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	7.65E-12	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527177036	NA	4.81E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251