| Variant ID: vg0527173808 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 27173808 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACACCATCTCTTCATTTTGTATTCCTTGTCGAGATCCACCAACCGTTCTCGAGCGATCGAGAAGGCGTAGAATCTGCGACGAAGCCTTGTCAACATTTGT[C/T]
GTACTCGCCTTAGTCGATCTTGGTGTAGAACCATAGAGACGTGAAGTCTTCGACAATGTCAAATAGAATTTTCCTGAAATCAATACTTAGAAAACAATAT
ATATTGTTTTCTAAGTATTGATTTCAGGAAAATTCTATTTGACATTGTCGAAGACTTCACGTCTCTATGGTTCTACACCAAGATCGACTAAGGCGAGTAC[G/A]
ACAAATGTTGACAAGGCTTCGTCGCAGATTCTACGCCTTCTCGATCGCTCGAGAACGGTTGGTGGATCTCGACAAGGAATACAAAATGAAGAGATGGTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.00% | 0.10% | 6.73% | 54.15% | NA |
| All Indica | 2759 | 23.10% | 0.10% | 10.04% | 66.76% | NA |
| All Japonica | 1512 | 59.50% | 0.10% | 1.39% | 39.02% | NA |
| Aus | 269 | 83.60% | 0.00% | 2.23% | 14.13% | NA |
| Indica I | 595 | 24.50% | 0.30% | 12.94% | 62.18% | NA |
| Indica II | 465 | 23.90% | 0.20% | 11.40% | 64.52% | NA |
| Indica III | 913 | 19.90% | 0.00% | 7.34% | 72.73% | NA |
| Indica Intermediate | 786 | 25.10% | 0.10% | 10.18% | 64.63% | NA |
| Temperate Japonica | 767 | 95.40% | 0.00% | 0.26% | 4.30% | NA |
| Tropical Japonica | 504 | 8.30% | 0.20% | 3.17% | 88.29% | NA |
| Japonica Intermediate | 241 | 52.30% | 0.00% | 1.24% | 46.47% | NA |
| VI/Aromatic | 96 | 47.90% | 0.00% | 5.21% | 46.88% | NA |
| Intermediate | 90 | 41.10% | 0.00% | 10.00% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0527173808 | C -> T | LOC_Os05g46954.2 | downstream_gene_variant ; 2425.0bp to feature; MODIFIER | silent_mutation | Average:10.863; most accessible tissue: Callus, score: 48.394 | N | N | N | N |
| vg0527173808 | C -> T | LOC_Os05g47442.1 | downstream_gene_variant ; 4086.0bp to feature; MODIFIER | silent_mutation | Average:10.863; most accessible tissue: Callus, score: 48.394 | N | N | N | N |
| vg0527173808 | C -> T | LOC_Os05g46954.1 | downstream_gene_variant ; 2407.0bp to feature; MODIFIER | silent_mutation | Average:10.863; most accessible tissue: Callus, score: 48.394 | N | N | N | N |
| vg0527173808 | C -> T | LOC_Os05g46954-LOC_Os05g47442 | intergenic_region ; MODIFIER | silent_mutation | Average:10.863; most accessible tissue: Callus, score: 48.394 | N | N | N | N |
| vg0527173808 | C -> DEL | N | N | silent_mutation | Average:10.863; most accessible tissue: Callus, score: 48.394 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0527173808 | NA | 1.53E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527173808 | 3.73E-06 | NA | mr1742_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0527173808 | 3.66E-07 | 2.63E-08 | mr1871_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |