Variant ID: vg0527153110 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 27153110 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 82. )
GTGCAATCACAAAGTGGAGGTATAAGTAGCCATTTTACGTCTTCTGTGCACATCAAATGTTAGATGTGCCTTGTAAATTCTTTAAGTTATTTTTCAGGTA[G/A]
ATGCTTTTCCATTTTTTGCTGGGCCATCAGTATCTTAGTCTTTGTTCCTGACAGGCACTATCGATCGGCTAGATGTTCTTGAACTCTTGAATGCCTGATG
CATCAGGCATTCAAGAGTTCAAGAACATCTAGCCGATCGATAGTGCCTGTCAGGAACAAAGACTAAGATACTGATGGCCCAGCAAAAAATGGAAAAGCAT[C/T]
TACCTGAAAAATAACTTAAAGAATTTACAAGGCACATCTAACATTTGATGTGCACAGAAGACGTAAAATGGCTACTTATACCTCCACTTTGTGATTGCAC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 22.00% | 5.10% | 0.87% | 72.07% | NA |
All Indica | 2759 | 3.60% | 0.80% | 1.16% | 94.45% | NA |
All Japonica | 1512 | 58.10% | 0.10% | 0.46% | 41.34% | NA |
Aus | 269 | 0.00% | 78.40% | 0.37% | 21.19% | NA |
Indica I | 595 | 5.50% | 0.30% | 2.02% | 92.10% | NA |
Indica II | 465 | 5.40% | 0.40% | 1.08% | 93.12% | NA |
Indica III | 913 | 0.80% | 0.20% | 0.66% | 98.36% | NA |
Indica Intermediate | 786 | 4.20% | 2.20% | 1.15% | 92.49% | NA |
Temperate Japonica | 767 | 95.00% | 0.00% | 0.26% | 4.69% | NA |
Tropical Japonica | 504 | 5.20% | 0.00% | 0.79% | 94.05% | NA |
Japonica Intermediate | 241 | 51.50% | 0.40% | 0.41% | 47.72% | NA |
VI/Aromatic | 96 | 36.50% | 2.10% | 0.00% | 61.46% | NA |
Intermediate | 90 | 28.90% | 4.40% | 1.11% | 65.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0527153110 | G -> DEL | N | N | silent_mutation | Average:13.852; most accessible tissue: Callus, score: 83.649 | N | N | N | N |
vg0527153110 | G -> A | LOC_Os05g46910.1 | downstream_gene_variant ; 3813.0bp to feature; MODIFIER | silent_mutation | Average:13.852; most accessible tissue: Callus, score: 83.649 | N | N | N | N |
vg0527153110 | G -> A | LOC_Os05g46920.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.852; most accessible tissue: Callus, score: 83.649 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0527153110 | NA | 6.83E-19 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | NA | 5.90E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | NA | 3.50E-08 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | NA | 2.26E-11 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | 6.30E-06 | NA | mr1350_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | NA | 1.03E-14 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | NA | 7.62E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | NA | 1.59E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | NA | 5.29E-13 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | NA | 2.52E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0527153110 | NA | 1.16E-07 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |