\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527153110:

Variant ID: vg0527153110 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27153110
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCAATCACAAAGTGGAGGTATAAGTAGCCATTTTACGTCTTCTGTGCACATCAAATGTTAGATGTGCCTTGTAAATTCTTTAAGTTATTTTTCAGGTA[G/A]
ATGCTTTTCCATTTTTTGCTGGGCCATCAGTATCTTAGTCTTTGTTCCTGACAGGCACTATCGATCGGCTAGATGTTCTTGAACTCTTGAATGCCTGATG

Reverse complement sequence

CATCAGGCATTCAAGAGTTCAAGAACATCTAGCCGATCGATAGTGCCTGTCAGGAACAAAGACTAAGATACTGATGGCCCAGCAAAAAATGGAAAAGCAT[C/T]
TACCTGAAAAATAACTTAAAGAATTTACAAGGCACATCTAACATTTGATGTGCACAGAAGACGTAAAATGGCTACTTATACCTCCACTTTGTGATTGCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.00% 5.10% 0.87% 72.07% NA
All Indica  2759 3.60% 0.80% 1.16% 94.45% NA
All Japonica  1512 58.10% 0.10% 0.46% 41.34% NA
Aus  269 0.00% 78.40% 0.37% 21.19% NA
Indica I  595 5.50% 0.30% 2.02% 92.10% NA
Indica II  465 5.40% 0.40% 1.08% 93.12% NA
Indica III  913 0.80% 0.20% 0.66% 98.36% NA
Indica Intermediate  786 4.20% 2.20% 1.15% 92.49% NA
Temperate Japonica  767 95.00% 0.00% 0.26% 4.69% NA
Tropical Japonica  504 5.20% 0.00% 0.79% 94.05% NA
Japonica Intermediate  241 51.50% 0.40% 0.41% 47.72% NA
VI/Aromatic  96 36.50% 2.10% 0.00% 61.46% NA
Intermediate  90 28.90% 4.40% 1.11% 65.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527153110 G -> DEL N N silent_mutation Average:13.852; most accessible tissue: Callus, score: 83.649 N N N N
vg0527153110 G -> A LOC_Os05g46910.1 downstream_gene_variant ; 3813.0bp to feature; MODIFIER silent_mutation Average:13.852; most accessible tissue: Callus, score: 83.649 N N N N
vg0527153110 G -> A LOC_Os05g46920.1 intron_variant ; MODIFIER silent_mutation Average:13.852; most accessible tissue: Callus, score: 83.649 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527153110 NA 6.83E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 NA 5.90E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 NA 3.50E-08 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 NA 2.26E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 6.30E-06 NA mr1350_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 NA 1.03E-14 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 NA 7.62E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 NA 1.59E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 NA 5.29E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 NA 2.52E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527153110 NA 1.16E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251