Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527125919:

Variant ID: vg0527125919 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27125919
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCTGTGCGTGGCAACAAGATTTTAAATAAAGAAAATTATCATTAACTCATTATTATTATCATTTTCTGTGTATATCGCCCCTTAATTTATGTATATATT[T/G]
GTTACTGACATGTGCACTGTCCTTTTCTTCTCACAAAAAGTAGGAAGTTGGTGGTAGGGGTGGTTGACATGTAGGCCCCCCTTTTCTATTAAAAAAACTA

Reverse complement sequence

TAGTTTTTTTAATAGAAAAGGGGGGCCTACATGTCAACCACCCCTACCACCAACTTCCTACTTTTTGTGAGAAGAAAAGGACAGTGCACATGTCAGTAAC[A/C]
AATATATACATAAATTAAGGGGCGATATACACAGAAAATGATAATAATAATGAGTTAATGATAATTTTCTTTATTTAAAATCTTGTTGCCACGCACAGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.10%	17.60%	26.70%	24.57%	NA
All Indica	2759	16.40%	11.50%	37.55%	34.54%	NA
All Japonica	1512	61.70%	18.40%	10.45%	9.46%	NA
Aus	269	4.10%	80.30%	7.81%	7.81%	NA
Indica I	595	16.30%	8.20%	50.92%	24.54%	NA
Indica II	465	17.60%	2.80%	38.49%	41.08%	NA
Indica III	913	16.30%	14.10%	29.79%	39.76%	NA
Indica Intermediate	786	15.90%	16.00%	35.88%	32.19%	NA
Temperate Japonica	767	95.40%	3.10%	1.30%	0.13%	NA
Tropical Japonica	504	12.90%	41.70%	23.21%	22.22%	NA
Japonica Intermediate	241	56.40%	18.30%	12.86%	12.45%	NA
VI/Aromatic	96	43.80%	6.20%	21.88%	28.12%	NA
Intermediate	90	35.60%	16.70%	28.89%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527125919	T -> DEL	N	N	silent_mutation	Average:7.845; most accessible tissue: Callus, score: 34.081	N	N	N	N
vg0527125919	T -> G	LOC_Os05g46845.1	upstream_gene_variant ; 603.0bp to feature; MODIFIER	silent_mutation	Average:7.845; most accessible tissue: Callus, score: 34.081	N	N	N	N
vg0527125919	T -> G	LOC_Os05g46874.1	upstream_gene_variant ; 3840.0bp to feature; MODIFIER	silent_mutation	Average:7.845; most accessible tissue: Callus, score: 34.081	N	N	N	N
vg0527125919	T -> G	LOC_Os05g46840.1	downstream_gene_variant ; 3007.0bp to feature; MODIFIER	silent_mutation	Average:7.845; most accessible tissue: Callus, score: 34.081	N	N	N	N
vg0527125919	T -> G	LOC_Os05g46860.1	intron_variant ; MODIFIER	silent_mutation	Average:7.845; most accessible tissue: Callus, score: 34.081	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527125919	1.31E-07	2.29E-15	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527125919	NA	8.05E-06	mr1482	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527125919	NA	3.11E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527125919	NA	2.19E-07	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527125919	NA	7.41E-09	mr1715_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251