\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527112841:

Variant ID: vg0527112841 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27112841
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.44, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


CACACCCTGAACCCACTAACATTGCTTGGGATGAGTTCGCTACGGCTTTCCGTGCAGCTCATGTGCCCGAAAGCACTATTGACATGAAGAAAGAAGAATT[C/T]
AACAGACTTAAACAAGGCAACAACAGTGTCAATGAGTACCTAAGTCAGTTCAACAAGTTGGCTCGGTACGCCCCTGAGGAAGTTGACTTCCTAGCCAAAC

Reverse complement sequence

GTTTGGCTAGGAAGTCAACTTCCTCAGGGGCGTACCGAGCCAACTTGTTGAACTGACTTAGGTACTCATTGACACTGTTGTTGCCTTGTTTAAGTCTGTT[G/A]
AATTCTTCTTTCTTCATGTCAATAGTGCTTTCGGGCACATGAGCTGCACGGAAAGCCGTAGCGAACTCATCCCAAGCAATGTTAGTGGGTTCAGGGTGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 19.20% 8.74% 5.50% NA
All Indica  2759 92.00% 1.80% 5.65% 0.51% NA
All Japonica  1512 16.50% 53.00% 14.42% 16.14% NA
Aus  269 88.50% 3.30% 8.18% 0.00% NA
Indica I  595 94.50% 1.30% 4.03% 0.17% NA
Indica II  465 87.70% 3.00% 6.67% 2.58% NA
Indica III  913 95.50% 1.40% 3.07% 0.00% NA
Indica Intermediate  786 88.50% 2.00% 9.29% 0.13% NA
Temperate Japonica  767 8.10% 88.40% 2.09% 1.43% NA
Tropical Japonica  504 28.00% 3.20% 34.72% 34.13% NA
Japonica Intermediate  241 19.10% 44.40% 11.20% 25.31% NA
VI/Aromatic  96 68.80% 25.00% 5.21% 1.04% NA
Intermediate  90 62.20% 23.30% 13.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527112841 C -> T LOC_Os05g46810.1 synonymous_variant ; p.Phe514Phe; LOW synonymous_codon Average:12.766; most accessible tissue: Zhenshan97 flag leaf, score: 21.009 N N N N
vg0527112841 C -> DEL LOC_Os05g46810.1 N frameshift_variant Average:12.766; most accessible tissue: Zhenshan97 flag leaf, score: 21.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527112841 NA 3.18E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 9.38E-06 mr1084 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 4.47E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 5.91E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 6.39E-08 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 3.93E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 1.10E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 8.22E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 8.03E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 1.63E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 1.82E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 3.02E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 3.72E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 5.65E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 1.23E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 8.97E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 6.85E-08 NA mr1221_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 4.85E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 2.45E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 NA 1.28E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527112841 5.01E-06 NA mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251