\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527080981:

Variant ID: vg0527080981 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27080981
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, C: 0.26, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CTCACAGGAACCAACCATATAAAAAATAAACTCAAACGGACGAAATATATAACATGTGGAATTTTCCAAAGCTCTACCGAAAAACTTCTCTCCTCGAAAA[T/C]
ACAATCTTGCAAGCGGAATTTGGAGGTTTTAATATCGCCGAACCCGGCGAAGCAGGGAGAATCGGATGTAACTTTTTCTGTAGATGTCCGTGCATATATT

Reverse complement sequence

AATATATGCACGGACATCTACAGAAAAAGTTACATCCGATTCTCCCTGCTTCGCCGGGTTCGGCGATATTAAAACCTCCAAATTCCGCTTGCAAGATTGT[A/G]
TTTTCGAGGAGAGAAGTTTTTCGGTAGAGCTTTGGAAAATTCCACATGTTATATATTTCGTCCGTTTGAGTTTATTTTTTATATGGTTGGTTCCTGTGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.80% 6.80% 51.29% 20.08% NA
All Indica  2759 2.40% 10.50% 60.24% 26.86% NA
All Japonica  1512 58.10% 1.20% 31.08% 9.59% NA
Aus  269 14.90% 1.50% 71.75% 11.90% NA
Indica I  595 1.50% 18.70% 37.65% 42.18% NA
Indica II  465 2.60% 9.00% 58.06% 30.32% NA
Indica III  913 2.40% 8.10% 74.26% 15.22% NA
Indica Intermediate  786 2.90% 8.00% 62.34% 26.72% NA
Temperate Japonica  767 95.30% 0.10% 4.04% 0.52% NA
Tropical Japonica  504 5.00% 3.00% 73.81% 18.25% NA
Japonica Intermediate  241 51.00% 0.80% 27.80% 20.33% NA
VI/Aromatic  96 20.80% 2.10% 64.58% 12.50% NA
Intermediate  90 28.90% 8.90% 41.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527080981 T -> DEL N N silent_mutation Average:12.104; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0527080981 T -> C LOC_Os05g46760.1 upstream_gene_variant ; 3616.0bp to feature; MODIFIER silent_mutation Average:12.104; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0527080981 T -> C LOC_Os05g46770.1 upstream_gene_variant ; 4251.0bp to feature; MODIFIER silent_mutation Average:12.104; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0527080981 T -> C LOC_Os05g46770.2 upstream_gene_variant ; 4251.0bp to feature; MODIFIER silent_mutation Average:12.104; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0527080981 T -> C LOC_Os05g46760-LOC_Os05g46770 intergenic_region ; MODIFIER silent_mutation Average:12.104; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527080981 NA 1.45E-12 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527080981 2.96E-06 2.96E-06 mr1782 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527080981 NA 1.38E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527080981 NA 2.12E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251