\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527042739:

Variant ID: vg0527042739 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27042739
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGTGCGCGCGGAAAAAGAAAGGGGGAGTTGGTAACTCCTGGTAACAACGTAGCCTTAGTTCACATTTTTATAATTTTAAACATTTAAGCTAAAAAATTT[A/G]
GACGAAAAGACATCCCTTCAACATTCTTAGAAAGAAATCGTAAGTGTGTTGAAGATTGAACATCTCTGAGCAAGTACATCTCTAAGCATTTAAGCAGCTT

Reverse complement sequence

AAGCTGCTTAAATGCTTAGAGATGTACTTGCTCAGAGATGTTCAATCTTCAACACACTTACGATTTCTTTCTAAGAATGTTGAAGGGATGTCTTTTCGTC[T/C]
AAATTTTTTAGCTTAAATGTTTAAAATTATAAAAATGTGAACTAAGGCTACGTTGTTACCAGGAGTTACCAACTCCCCCTTTCTTTTTCCGCGCGCACGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 19.20% 0.04% 0.00% NA
All Indica  2759 99.30% 0.60% 0.07% 0.00% NA
All Japonica  1512 43.10% 56.90% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.13% 0.00% NA
Temperate Japonica  767 5.10% 94.90% 0.00% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527042739 A -> G LOC_Os05g46710.1 upstream_gene_variant ; 3655.0bp to feature; MODIFIER silent_mutation Average:95.85; most accessible tissue: Minghui63 young leaf, score: 97.855 N N N N
vg0527042739 A -> G LOC_Os05g46720.1 upstream_gene_variant ; 579.0bp to feature; MODIFIER silent_mutation Average:95.85; most accessible tissue: Minghui63 young leaf, score: 97.855 N N N N
vg0527042739 A -> G LOC_Os05g46710.2 upstream_gene_variant ; 3519.0bp to feature; MODIFIER silent_mutation Average:95.85; most accessible tissue: Minghui63 young leaf, score: 97.855 N N N N
vg0527042739 A -> G LOC_Os05g46720.2 upstream_gene_variant ; 732.0bp to feature; MODIFIER silent_mutation Average:95.85; most accessible tissue: Minghui63 young leaf, score: 97.855 N N N N
vg0527042739 A -> G LOC_Os05g46710-LOC_Os05g46720 intergenic_region ; MODIFIER silent_mutation Average:95.85; most accessible tissue: Minghui63 young leaf, score: 97.855 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0527042739 A G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527042739 NA 3.02E-24 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 8.45E-39 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 1.25E-21 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 1.11E-06 4.56E-46 mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 6.96E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 4.60E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 4.65E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 3.03E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 3.29E-35 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 5.39E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 8.37E-10 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 6.89E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 9.08E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 1.08E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 2.54E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527042739 NA 1.32E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251